In four rice genomes,85 ABC1-family genes were identified by comparative genomics,evolution,genetics,and physiology.One,OsABC1-13,was shown by knockdown and knockout experiments to affect plant height,grain size,and p...In four rice genomes,85 ABC1-family genes were identified by comparative genomics,evolution,genetics,and physiology.One,OsABC1-13,was shown by knockdown and knockout experiments to affect plant height,grain size,and photosynthetic capability.展开更多
Panax ginseng C.A.Mey.is an important plant species used in traditional Chinese medicine,whose primary active ingredient is a ginsenoside.Ginsenoside biosynthesis is not only regulated by transcription factors but als...Panax ginseng C.A.Mey.is an important plant species used in traditional Chinese medicine,whose primary active ingredient is a ginsenoside.Ginsenoside biosynthesis is not only regulated by transcription factors but also controlled by a variety of structural genes.Nonetheless,the molecular mechanism underlying ginsenoside biosynthesis has always been a topic in the discussion of ginseng secondary metabolites.Squalene epoxidase(SQE)is a key enzyme in the mevalonic acid pathway,which affects the biosynthesis of secondary metabolites such as terpenoid.Using ginseng transcriptome,expression,and ginsenoside content databases,this study employed bioinformatic methods to systematically analyze the genes encoding SQE in ginseng.We first selected six PgSQE candidates that were closely involved in ginsenoside biosynthesis and then identified PgSQE08-01 to be highly associated with ginsenoside biosynthesis.Next,we constructed the overexpression vector pCAMBIA3301-PgSQE08-01 and the RNAi vector pART27-PgSQE08-01 and transformed ginseng adventitious roots using Agrobacterium rhizogenes,to obtain positive hairy-root clones.Thereafter,quantitative reverse transcriptionpolymerase chain reaction and high-performance liquid chromatography were used to determine the expression of relevant genes and ginsenoside content,respectively.Then,we focused on the function of PgSQE08-01 gene,which was noted to be involved in ginsenoside biosynthesis.Thus,these findings not only provided a molecular basis for the identification of important functional genes in ginseng but also enriched genetic resources for the biosynthesis of ginsenosides using synthetic biology.展开更多
BACKGROUND Prion diseases are a group of degenerative nerve diseases that are caused by infectious prion proteins or gene mutations.In humans,prion diseases result from mutations in the prion protein gene(PRNP).Only a...BACKGROUND Prion diseases are a group of degenerative nerve diseases that are caused by infectious prion proteins or gene mutations.In humans,prion diseases result from mutations in the prion protein gene(PRNP).Only a limited number of cases involving a specific PRNP mutation at codon 196(E196A)have been reported.The coexistence of Korsakoff syndrome in patients with Creutzfeldt-Jakob disease(CJD)caused by E196A mutation has not been documented in the existing literature.CASE SUMMARY A 61-year-old Chinese man initially presented with Korsakoff syndrome,followed by rapid-onset dementia,visual hallucinations,akinetic mutism,myoclonus,and hyperthermia.The patient had no significant personal or familial medical history.Magnetic resonance imaging of the brain revealed extensive hyperintense signals in the cortex,while positron emission tomography/computed tomography showed a diffuse reduction in cerebral cortex metabolism.Routine biochemical and microorganism testing of the cerebrospinal fluid(CSF)yielded normal results.Tests for thyroid function,human immunodeficiency virus,syphilis,vitamin B1 and B12 levels,and autoimmune rheumatic disorders were normal.Blood and CSF tests for autoimmune encephalitis and autoantibody-associated paraneoplastic syndrome yielded negative results.A test for 14-3-3 protein in the CSF yielded negative results.Whole-genome sequencing revealed a diseasecausing mutation in PRNP.The patient succumbed to the illness 11 months after the initial symptom onset.CONCLUSION Korsakoff syndrome,typically associated with alcohol intoxication,also manifests in CJD patients.Individuals with CJD along with PRNP E196A mutation may present with Korsakoff syndrome.展开更多
Background:This study explores the relationship between endoplasmic reticulum(ER)stress and diabetes,particularly focusing on the impact of physical exercise on ER stress mechanisms and identifying potential therapeut...Background:This study explores the relationship between endoplasmic reticulum(ER)stress and diabetes,particularly focusing on the impact of physical exercise on ER stress mechanisms and identifying potential therapeutic drugs and targets for diabetes-related sepsis.The research also incorporates traditional physical therapy perspectives,emphasizing the genomic insights gained from exercise therapy in disease management and prevention.Methods:Gene analysis was conducted on the GSE168796 and GSE94717 datasets to identify ER stress-related genes.Gene interactions and immune cell correlations were mapped using GeneCard and STRING databases.A screening of 2,456 compounds from the TCMSP database was performed to identify potential therapeutic agents,with a focus on their docking potential.Techniques such as luciferase reporter gene assay and RNA interference were used to examine the interactions between microRNA-149-5p and MMP9.Results:The study identified 2,006 differentially expressed genes and 616 miRNAs.Key genes like MMP9,TNF-α,and IL1B were linked to an immunosuppressive state.Licorice glycoside E demonstrated high affinity for MMP9,suggesting its potential effectiveness in treating diabetes.The constructed miRNA network highlighted the regulatory roles of MMP9,IL1B,IFNG,and TNF-α.Experimental evidence confirmed the binding of microRNA-149-5p to MMP9,impacting apoptosis in diabetic cells.Conclusion:The findings highlight the regulatory role of microRNA-149-5p in managing MMP9,a crucial gene in diabetes pathophysiology.Licorice glycoside E emerges as a promising treatment option for diabetes,especially targeting MMP9 affected by ER stress.The study also underscores the significance of physical exercise in modulating ER stress pathways in diabetes management,bridging traditional physical therapy and modern scientific understanding.Our study has limitations.It focuses on the microRNA-149-5p-MMP9 network in sepsis,using cell-based methods without animal or clinical trials.Despite strong in vitro findings,in vivo studies are needed to confirm licorice glycoside E’s therapeutic potential and understand the microRNA-149-5p-MMP9 dynamics in real conditions.展开更多
The 14-3-3 protein, highly conserved in all eukaryotic cells, is an important regulatory protein. It plays an important role in the growth, amplification, apoptosis, signal transduction, and other crucial life activit...The 14-3-3 protein, highly conserved in all eukaryotic cells, is an important regulatory protein. It plays an important role in the growth, amplification, apoptosis, signal transduction, and other crucial life activities of cells. A eDNA encoding a putative 14-3-3 protein was isolated from cotton fiber eDNA library. The eDNA, designated as Gh14-3-3L （Gossypium hirsutum 14-3-3-like）, is 1,029 bp in length （including a 762 bp long open reading frame and 5＇-/3＇-untranslated regions） and deduced a protein with 253 amino acids. The GhI4-3-3L shares higher homology with the known plant 14-3-3 proteins, and possesses the basic structure of 14-3-3 proteins： one dimeric domain, one phosphoralated-serine rich motif, four CC domains, and one EF Hand motif. Northern blotting analysis showed that Gh14-3-3L was predominantly expressed during early fiber development, and reached to the peak of expression in 10 days post anthers （DPA） fiber cells, suggesting that the gene may be involved in regulating fiber elongation. The gene is also expressed at higher level in both ovule and petal, but displays lower or undeteetable level of activity in other tissues of cotton.展开更多
Delta-12 oleate desaturase gene （FAD2-1） which converts oleic acid into linoleic acid, is the key enzyme determining the fatty acid composition of cottonseed oil. By employing RT-PCR method, full length cDNA of cott...Delta-12 oleate desaturase gene （FAD2-1） which converts oleic acid into linoleic acid, is the key enzyme determining the fatty acid composition of cottonseed oil. By employing RT-PCR method, full length cDNA of cotton delta-12 oleate desat- urase gene GhFAD2-1 containing an open reading frame of 1 158 bp was cloned for constructing RNAi vector. A 515 bp long specific fragment of this gene was se- lected for constructing ihpRNA vector under the control of a seed-specific promoter NAPIN, named pFGC1008-NAPIN-FAD2-1; meanwhile miRNA gene-silencing vector pCAMBIA1302-amiRNA-FAD2-1 targeting GhFAD2-1 was also constructed.展开更多
AIM: To study the activation of cytotoxic T lymphocytes (CTLs) against gastric cancer cells induced by FasL/B7-1 (FB-11) gene-modified tumor cells, and to explore whether co-expression of FasL and B7-1 in SGC-7901 tum...AIM: To study the activation of cytotoxic T lymphocytes (CTLs) against gastric cancer cells induced by FasL/B7-1 (FB-11) gene-modified tumor cells, and to explore whether co-expression of FasL and B7-1 in SGC-7901 tumor cells could initiate synergistic antitumor effect. METHODS: FasL and B7-1 genes were transfected into human SGC-7901 gastric cancer cells with adenovirus vectors. The positive clones were selected by G418. FasL and B7-1 genes were detected by flow cytometry and RT-PCR. Abdominal infiltrating lymphocytes and sensitized spleen cells were obtained from mice that were immunized with SGC-7901/FB-11 or wild type SGC-7901 cells intraperitoneally, and cytotoxicity of these CTLs against tumor cells was determined by MTT assay. RESULTS: Flow cytometry and RT-PCR showed that FasL and B7-1 genes were highly expressed. FasL and B7-1 transfected cancer cells had a high apoptosis index. DNA laddering suggested that FasL and B7-1 genes induced gastric cancer cell apoptosis. FasL+/B7-1+SGC-7901 cells (SGC-7901/FB-11) were inoculated subcutaneously in the dorsal skin of C57BL/6 mice and then decreased their tumorigenicity greatly (z = 2.15-46.10, P＜0.01). SGC- 7901/FB-11 cell-sensitized mice obtained protective immune activity against the rechallenge of wild type SGC 7901 cells (z = 2.06-44.30, P＜0.05). The cytotoxicity of CTLs induced by SGC-7901/FB-11 cells against SGC-7901 was significantly higher than that of CTLs activated by wild-type SGC-7901 cells (84.1±2.4% vs30.5±2.3%,P＜0.05).CONCLUSION: FasL and B7-1 genes can effectively promote the activity of CTLs against gastric cancer cells. FasL/B7-1 molecules play an important role in CTL cytotoxicity.展开更多
Objective： To construct eukaryotic expression vector containing B7-1/GFP geneand study its expression in osteosarcoma cell line LM8. Methods： By using gene cloning technique, eukaxyotic expression vector pEGFP-C1 wa...Objective： To construct eukaryotic expression vector containing B7-1/GFP geneand study its expression in osteosarcoma cell line LM8. Methods： By using gene cloning technique, eukaxyotic expression vector pEGFP-C1 was used to construct the murine B7-1 recombinant plasmid （pEGFP-C1/B7）. Recombinant plasmid was transfected into LM8 cells with liposome and was confirmed by restriction endonuclease digestion and DNA sequencing. The expression of the fusion protein was detected using fluorescence microscope and Western blot analysis. Results： The recombinant eukaryotic expression plasmid pEGFP-C1/B7 was successfully constructed, which was confirmed by DNA sequencing, RT-PGR and restriction enzymes analysis. The green fluorescent protein could be detected in the transfected LM8 with fluorescence microscope. The expected B7-1 and green fluorescent protein （GFP） fusion protein was detected by RT-PCR and Western blot. Conclusion： The eukaryotic expression vector containing B7-1/GFP gene was constructed successfully, and it could be expressed in LM8 after transfection.展开更多
Aroma is an important quality trait of grapes and often the focus of consumers,viticulturists and grapevine breeders.Kyoho is a hybrid between Vitis vinifera and Vitis labrusca with a strawberry-like scent,while 87-1 ...Aroma is an important quality trait of grapes and often the focus of consumers,viticulturists and grapevine breeders.Kyoho is a hybrid between Vitis vinifera and Vitis labrusca with a strawberry-like scent,while 87-1 is an early-ripening mutant of Muscat hamburg,belonging to Vitis vinifera,with a rose scent.In this study,we compared their aroma compositions and concentrations during berry development by headspace-SPME combined with gas chromatography-mass spectrometry(GC-MS),and analyzed the expression differences of enzyme-encoding genes in the LOX-HPL,MEP and MVA metabolic pathways by qRT-PCR.Twelve esters were detected in Kyoho during the whole berry development and they were abundant after veraison,but no esters were detected in 87-1 berries.Linalool was the dominant terpene among the 14 terpenes detected in 87-1 berries,while limited amounts of terpenes were detected in Kyoho berries.qRT-PCR analysis indicated that the low expression of VvAAT might explain the low content of ester volatiles in 87-1 berries,and the low expression of coding genes in the MEP pathway,especially VvPNLin Ner1,might be the reason for the low content of volatile terpenes in Kyoho berries.The results from this work will promote our understanding of aroma metabolic mechanisms of grapes,and offer some suggestions for grape aromatic quality improvement.展开更多
Pigs are an important resource in agriculture and serve as a model for human diseases. Due to their physiological and anatomical similarities with humans, pigs can recapitulate symptoms of human diseases, making them ...Pigs are an important resource in agriculture and serve as a model for human diseases. Due to their physiological and anatomical similarities with humans, pigs can recapitulate symptoms of human diseases, making them a useful model in biomedicine. However, in the past pig models have not been widely used partially because of the difficulty in genetic modification. The lack of true embryonic stem cells in pigs forced researchers to utilize genetic modification in somatic cells and somatic cell nuclear transfer(SCNT) to generate genetically engineered(GE) pigs carrying site-specific modifications. Although possible, this approach is extremely inefficient and GE pigs born through this method often presented developmental defects associated with the cloning process. Advancement in the gene-editing systems such as Zinc-Finger Nucleases(ZFNs), Transcription activator-like effector nucleases(TALENs), and the Clustered regularly interspaced short palindromic repeat(CRISPR)/CRISPR-associated 9(Cas9) system have dramatically increased the efficiency of producing GE pigs. These gene-editing systems, specifically engineered endonucleases, are based on inducing double-stranded breaks(DSBs) at a specific location, and then site-specific modifications can be introduced through one of the two DNA repair pathways: non-homologous end joining(NHEJ) or homology direct repair(HDR).Random insertions or deletions(indels) can be introduced through NHEJ and specific nucleotide sequences can be introduced through HDR, if donor DNA is provided. Use of these engineered endonucleases provides a higher success in genetic modifications, multiallelic modification of the genome, and an opportunity to introduce site-specific modifications during embryogenesis, thus bypassing the need of SCNT in GE pig production. This review will provide a historical prospective of GE pig production and examples of how the gene-editing system, led by engineered endonucleases, have improved GE pig production. We wil also present some of our current progress related to the optimal use of CRISPR/Cas9 system during embryogenesis.展开更多
Polyunsaturated fatty acids （PUFAs） are essential for normal growth in mammals, especially the ω-3 PUFAs, which play important roles in preventing several life-threatening diseases, such as coronary heart disease a...Polyunsaturated fatty acids （PUFAs） are essential for normal growth in mammals, especially the ω-3 PUFAs, which play important roles in preventing several life-threatening diseases, such as coronary heart disease and diabetes. In this study, we aimed to investigate whether the sFat-1 gene from Caenorhabditis briggsae could be functionally expressed in transgenic pigs, and whether the transgenic could synthesize high quality ω-3 PUFAs endogenously. In this study, a gene construct consisting of CMV promoter and 1.9 kb cDNA of ω-3 fatty acid desaturase gene （sFat-1） from C. briggsae was injected into the male pronucleus of pig embryos by microinjection. The piglets were screened for the transgene by PCR, Southern blot and reverse transcription-PCR analysis. Pigs that give positive results were mated with wild-type pigs to produce the next generation and the transmission of transgene was examined by PCR analysis. Fatty acids compositions of various tissues in the transgenic pigs were then analyzed by gas chromatograph. A total of 878 embryos were transferred into 42 recipients, among which 29 successfully got pregnant and gave birth to a total of 162 piglets, and 8 of them were identified to be transgenic. Fatty acid compositions in the transgenic pigs were altered, and the levels of ω-6：ω-3 ratios were decreased from 14.53 in the control to 2.62 in Fat-1 transgenic pigs. A number of primary sFat-1-transgenic pigs were bred in this study, which lays the foundation for cultivation of new varieties of transgenic pigs.展开更多
AIM： To study the cloning of α-β fusion gene from Closindium perfringens and the immunogenidty of 0-6 fusion expression. METHODS： Cloning was accomplished after PCR amplification from strains NCTC64609 and C58-1 o...AIM： To study the cloning of α-β fusion gene from Closindium perfringens and the immunogenidty of 0-6 fusion expression. METHODS： Cloning was accomplished after PCR amplification from strains NCTC64609 and C58-1 of the protective antigen genes of α-toxin and β-toxin. The fragment of the gene was cloned using plasmid pZCPAB. This fragment coded for the gene with the stable expression of α-β fusion gene binding. In order to verify the exact location of the α-β fusion gene, domain plasmids were constructed. The two genes were fused into expression vector pBV221. The expressed α-β fusion protein was identified by ELISA, SDS-PAGE, Western blotting and neutralization assay. RESULTS： The protective co-toxin gene （cpa906） and the β-toxin gene （cpb930） were obtained. The recombinant plasmid pZCPAB carrying α-β fusion gene was constructed and transformed into BL21（DE3）. The recombinant strain BL21（DE3）（pZCPAB） was obtained. After the recombinant strain BL21（DE3）（pZCPAB） was induced by 42℃, its expressed product was about 22.14% of total cellular protein at SDS-PAGE and thin-layer gel scanning analysis. Neutralization assay indicated that the antibody induced by immunization with α-βfusion protein could neutralize the toxicity of α-toxin and β-toxin. CONCLUSION： The obtained α-toxin and β-toxin genes are correct. The recombinant strain BL21（DE3）（pZCPAB） could produce α-β fusion protein. This protein can be used for immunization and is immunogenic. The antibody induced by immunization with α-β fusion protein could neutralize the toxicity of α-toxin and β-toxin.展开更多
Objective To study the effect of microgene pSVP oMcat implanted to modify schwann cell on growth associated protein -43(GAP -43)expression after spinal cord injury in adult rats.Method Hemisected of the T8segment of t...Objective To study the effect of microgene pSVP oMcat implanted to modify schwann cell on growth associated protein -43(GAP -43)expression after spinal cord injury in adult rats.Method Hemisected of the T8segment of the sp inal cord was performed for all the experiment rats.The rats were randomly divided into three groups as follows:Group Awith microgene pSVPoMca t implanted to genetically modify SC;Group B with SC implanted ;Group C with hemisection of the spinal cord o nly.The changes of expression of GAP-43in spinal cord were observed by immunochemistry with antibodies against GAP -43.Simultaneous,the combined behavioral scores(CBS)was measured.Result There were not any different (P >0.05)among the three groups in first week a nd 12week.There were significant di ffeence(P <0.05)among three groups in 2nd,8th,and more dxpression of GAP -43at the 2nd week in gr oup A.The neurofunctional recovery was best in group A.Conclusion The microgene pSVPoMcat implanted t o modify schwann cell can promote the expression of GAP -43in spinal cord a nd func-tional recovery in adults rats after SCI.展开更多
Keratin-associated proteins (KAPs) are a major structural component of hair and wool fibres, and play a critical role in determining the properties of the fibre. To date, forty functional high sulphur KAP genes from f...Keratin-associated proteins (KAPs) are a major structural component of hair and wool fibres, and play a critical role in determining the properties of the fibre. To date, forty functional high sulphur KAP genes from fourteen families have been identified in humans, but only six functional high sulphur KAP genes have been identified in sheep. This led us to search for the ovine KAP13-3 gene, a gene encoding a high sulphur KAP. In this study, the notional KAP13- 3 gene (KRTAP13-3) was amplified using primers designed based on a reported bovine KRTAP13-3 se- quence. PCR-single stranded conformational polymorphism (PCR-SSCP) analysis was used to screen amplicons derived from the gene in one hundred and forty seven New Zealand Romney crossbred sheep. Five unique banding patterns were revealed. Either one PCR-SSCP pattern (homozygous) or a combination of two patterns (heterozygous) was observed for each sheep. Sequencing of PCR amplicons representtative of different SSCP patterns revealed five different DNA sequences. The sequences derived from the amplicons showed a low homology to other known ovine KRTAPs, but had a high homology with previous reported KRTAP13-n sequences from human and cattle, with the closest homology being with bovine KRTAP13-3, suggesting the sequences represent the ovine KRTAP13-3 locus. Among the five allele sequences, four nucleotide substitutions were identified within the coding region. Of these substitutions, three were non-synonymous and would result in amino acid changes (p.Arg79Cys, p.Arg81Gln and p.Tyr130His). This variation in the KAP13-3 gene may affect gene expression, the structure and assembly of the protein, and consequently influence wool traits, if KAP13-3 is of importance to wool fibre structure.展开更多
AIM: To investigate whether single-nucleotide polymor- phisms in the promoter regions of endotoxin-responsive genes CD14 C (-159) T is associated with chronic hepatitis B. METHODS: We obtained genomic DNA from 80 pati...AIM: To investigate whether single-nucleotide polymor- phisms in the promoter regions of endotoxin-responsive genes CD14 C (-159) T is associated with chronic hepatitis B. METHODS: We obtained genomic DNA from 80 patients with established diagnosis of chronic hepatitis B and 126 healthy subjects served as a control population. The CD 14 C (-159) T polymorphism was investigated using an allele specific PCR method. RESULTS: Twenty seven percent of chronic hepatitis B patients and 75% of controls were heterozygous for CT genotype. The difference between the chronic hepatitis B and control groups was statistically significant [P < 0.0001; Odds ratio (OR) = 2.887; 95% CI: 1.609-5.178]. Twenty four point six percent of chronic hepatitis B and patients 12.3% of the control group were heterozygous for TT genotype. The difference between groups was not statistically significant (P = 0.256; OR = 0.658; 95% CI: 0.319-1.358). Forty eight point four percent of chronic hepatitis B patients and 12.7% of control were homozy- gote for CC genotype (P < 0.004; OR = 0.416; 95% CI: 0.229-0.755). The frequency of allele C was 61.9% and allele T was 38.1% in hepatitis B patients group. The frequency of allele C was 55.2% and allele T was 44.8% for the control group (P = 0.179; OR = 1.319; 95% CI: 0.881-1.977). CONCLUSION: The TT heterozygous genotype was not a risk factor for chronic hepatitis B. CC homozygote genotype is protective for hepatitis B. Lack of heterozy- gosis of genotype CT is a risk factor for chronic hepatitis B. Alleles C or T were not risk factors for chronic hepatitis B. These findings show the role of a single-nucleotide polymorphism at CD14/-159 on the development ofchronic hepatitis B. Endotoxin susceptibility may play a role in the pathogenesis of chronic hepatitis B.展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
A 1 692 bp long chitinase-encoding ch/A gene was cloned from the genomic DNA of Serrat/a marcescens strain C8-8 by PCR, which was speculated to en- code a 563 aa long polypeptide chain with molecular weight of about 6...A 1 692 bp long chitinase-encoding ch/A gene was cloned from the genomic DNA of Serrat/a marcescens strain C8-8 by PCR, which was speculated to en- code a 563 aa long polypeptide chain with molecular weight of about 60.9 kD. Homolog analysis showed that the chiA gene sequence cloned from C8-8 shared the highest similarity with cMA sequences from Serrat/a maresscens strains 141 （ DQ 990373.1 ） and 14041 （ DQ 493896. 1 ）, which reached 99%. Domain analysis showed that N-termlnal （23 aa） of the chiA gene cloned from C8-8 harbored typical signal peptide sequence, while C-telminal harbored the other two domains, in- eluding the PKD region （73 aa） and chitinase catalytic region （387 aa）. The PCR fragment was digested with restriction endonucleases and cloned into plasmid pET28a. The recombinant plasmid pET＇28a-ch/A was firstly transformed into Escherichia coli DI-I5 , and then transformed into expression host E. coli DH3 to express ch/A gene. The recombinant strain DH3 chiA could produce transparent hydrolysis circles on the colloidal chitin plate induced by isopropyl-l-thiogalactopyranoside （IFrG）. SDS-PAGE electrophoresis analysis showed that, a protein with relative molecular weight of about 60 kD was expressed by the recombinant strain DH3 chiA, which was consistent with the except molecular weight. After initial purification, biological activity test showed that the recombinant expression product could hydrolyze chitin, which produced transparent hydrolysis circles on the colloidal chitin plates. Results indicated that chiA gene from Serrat/a marcescens strain C8-8 had biological functions and could be utilized as a potential biological control factor.展开更多
基金supported by the Innovation Program of the Shanghai Municipal Education Commission(2023ZKZD05)the Shanghai Oriental Talent(Rural Revitalization)Top Talent Project(T2023102).
文摘In four rice genomes,85 ABC1-family genes were identified by comparative genomics,evolution,genetics,and physiology.One,OsABC1-13,was shown by knockdown and knockout experiments to affect plant height,grain size,and photosynthetic capability.
基金This work was supported by an award from the Department of Science and Technology of Jilin Province(20210402043GH and 20210204063YY).
文摘Panax ginseng C.A.Mey.is an important plant species used in traditional Chinese medicine,whose primary active ingredient is a ginsenoside.Ginsenoside biosynthesis is not only regulated by transcription factors but also controlled by a variety of structural genes.Nonetheless,the molecular mechanism underlying ginsenoside biosynthesis has always been a topic in the discussion of ginseng secondary metabolites.Squalene epoxidase(SQE)is a key enzyme in the mevalonic acid pathway,which affects the biosynthesis of secondary metabolites such as terpenoid.Using ginseng transcriptome,expression,and ginsenoside content databases,this study employed bioinformatic methods to systematically analyze the genes encoding SQE in ginseng.We first selected six PgSQE candidates that were closely involved in ginsenoside biosynthesis and then identified PgSQE08-01 to be highly associated with ginsenoside biosynthesis.Next,we constructed the overexpression vector pCAMBIA3301-PgSQE08-01 and the RNAi vector pART27-PgSQE08-01 and transformed ginseng adventitious roots using Agrobacterium rhizogenes,to obtain positive hairy-root clones.Thereafter,quantitative reverse transcriptionpolymerase chain reaction and high-performance liquid chromatography were used to determine the expression of relevant genes and ginsenoside content,respectively.Then,we focused on the function of PgSQE08-01 gene,which was noted to be involved in ginsenoside biosynthesis.Thus,these findings not only provided a molecular basis for the identification of important functional genes in ginseng but also enriched genetic resources for the biosynthesis of ginsenosides using synthetic biology.
文摘BACKGROUND Prion diseases are a group of degenerative nerve diseases that are caused by infectious prion proteins or gene mutations.In humans,prion diseases result from mutations in the prion protein gene(PRNP).Only a limited number of cases involving a specific PRNP mutation at codon 196(E196A)have been reported.The coexistence of Korsakoff syndrome in patients with Creutzfeldt-Jakob disease(CJD)caused by E196A mutation has not been documented in the existing literature.CASE SUMMARY A 61-year-old Chinese man initially presented with Korsakoff syndrome,followed by rapid-onset dementia,visual hallucinations,akinetic mutism,myoclonus,and hyperthermia.The patient had no significant personal or familial medical history.Magnetic resonance imaging of the brain revealed extensive hyperintense signals in the cortex,while positron emission tomography/computed tomography showed a diffuse reduction in cerebral cortex metabolism.Routine biochemical and microorganism testing of the cerebrospinal fluid(CSF)yielded normal results.Tests for thyroid function,human immunodeficiency virus,syphilis,vitamin B1 and B12 levels,and autoimmune rheumatic disorders were normal.Blood and CSF tests for autoimmune encephalitis and autoantibody-associated paraneoplastic syndrome yielded negative results.A test for 14-3-3 protein in the CSF yielded negative results.Whole-genome sequencing revealed a diseasecausing mutation in PRNP.The patient succumbed to the illness 11 months after the initial symptom onset.CONCLUSION Korsakoff syndrome,typically associated with alcohol intoxication,also manifests in CJD patients.Individuals with CJD along with PRNP E196A mutation may present with Korsakoff syndrome.
文摘Background:This study explores the relationship between endoplasmic reticulum(ER)stress and diabetes,particularly focusing on the impact of physical exercise on ER stress mechanisms and identifying potential therapeutic drugs and targets for diabetes-related sepsis.The research also incorporates traditional physical therapy perspectives,emphasizing the genomic insights gained from exercise therapy in disease management and prevention.Methods:Gene analysis was conducted on the GSE168796 and GSE94717 datasets to identify ER stress-related genes.Gene interactions and immune cell correlations were mapped using GeneCard and STRING databases.A screening of 2,456 compounds from the TCMSP database was performed to identify potential therapeutic agents,with a focus on their docking potential.Techniques such as luciferase reporter gene assay and RNA interference were used to examine the interactions between microRNA-149-5p and MMP9.Results:The study identified 2,006 differentially expressed genes and 616 miRNAs.Key genes like MMP9,TNF-α,and IL1B were linked to an immunosuppressive state.Licorice glycoside E demonstrated high affinity for MMP9,suggesting its potential effectiveness in treating diabetes.The constructed miRNA network highlighted the regulatory roles of MMP9,IL1B,IFNG,and TNF-α.Experimental evidence confirmed the binding of microRNA-149-5p to MMP9,impacting apoptosis in diabetic cells.Conclusion:The findings highlight the regulatory role of microRNA-149-5p in managing MMP9,a crucial gene in diabetes pathophysiology.Licorice glycoside E emerges as a promising treatment option for diabetes,especially targeting MMP9 affected by ER stress.The study also underscores the significance of physical exercise in modulating ER stress pathways in diabetes management,bridging traditional physical therapy and modern scientific understanding.Our study has limitations.It focuses on the microRNA-149-5p-MMP9 network in sepsis,using cell-based methods without animal or clinical trials.Despite strong in vitro findings,in vivo studies are needed to confirm licorice glycoside E’s therapeutic potential and understand the microRNA-149-5p-MMP9 dynamics in real conditions.
基金This work was supported by National Program for Basic Research (973 project) of China (No. 2004CB117304), the Ministry of Education of China (No. 104130), National Program for High Technology (863 Project) of China (No. 2005AA220270), and Na-tional Natural Sciences Foundation of China (No. 30470930).
文摘The 14-3-3 protein, highly conserved in all eukaryotic cells, is an important regulatory protein. It plays an important role in the growth, amplification, apoptosis, signal transduction, and other crucial life activities of cells. A eDNA encoding a putative 14-3-3 protein was isolated from cotton fiber eDNA library. The eDNA, designated as Gh14-3-3L （Gossypium hirsutum 14-3-3-like）, is 1,029 bp in length （including a 762 bp long open reading frame and 5＇-/3＇-untranslated regions） and deduced a protein with 253 amino acids. The GhI4-3-3L shares higher homology with the known plant 14-3-3 proteins, and possesses the basic structure of 14-3-3 proteins： one dimeric domain, one phosphoralated-serine rich motif, four CC domains, and one EF Hand motif. Northern blotting analysis showed that Gh14-3-3L was predominantly expressed during early fiber development, and reached to the peak of expression in 10 days post anthers （DPA） fiber cells, suggesting that the gene may be involved in regulating fiber elongation. The gene is also expressed at higher level in both ovule and petal, but displays lower or undeteetable level of activity in other tissues of cotton.
文摘Delta-12 oleate desaturase gene （FAD2-1） which converts oleic acid into linoleic acid, is the key enzyme determining the fatty acid composition of cottonseed oil. By employing RT-PCR method, full length cDNA of cotton delta-12 oleate desat- urase gene GhFAD2-1 containing an open reading frame of 1 158 bp was cloned for constructing RNAi vector. A 515 bp long specific fragment of this gene was se- lected for constructing ihpRNA vector under the control of a seed-specific promoter NAPIN, named pFGC1008-NAPIN-FAD2-1; meanwhile miRNA gene-silencing vector pCAMBIA1302-amiRNA-FAD2-1 targeting GhFAD2-1 was also constructed.
基金Supported by the Medical Scientific Foundation of Jiangsu Province, No. H200147
文摘AIM: To study the activation of cytotoxic T lymphocytes (CTLs) against gastric cancer cells induced by FasL/B7-1 (FB-11) gene-modified tumor cells, and to explore whether co-expression of FasL and B7-1 in SGC-7901 tumor cells could initiate synergistic antitumor effect. METHODS: FasL and B7-1 genes were transfected into human SGC-7901 gastric cancer cells with adenovirus vectors. The positive clones were selected by G418. FasL and B7-1 genes were detected by flow cytometry and RT-PCR. Abdominal infiltrating lymphocytes and sensitized spleen cells were obtained from mice that were immunized with SGC-7901/FB-11 or wild type SGC-7901 cells intraperitoneally, and cytotoxicity of these CTLs against tumor cells was determined by MTT assay. RESULTS: Flow cytometry and RT-PCR showed that FasL and B7-1 genes were highly expressed. FasL and B7-1 transfected cancer cells had a high apoptosis index. DNA laddering suggested that FasL and B7-1 genes induced gastric cancer cell apoptosis. FasL+/B7-1+SGC-7901 cells (SGC-7901/FB-11) were inoculated subcutaneously in the dorsal skin of C57BL/6 mice and then decreased their tumorigenicity greatly (z = 2.15-46.10, P＜0.01). SGC- 7901/FB-11 cell-sensitized mice obtained protective immune activity against the rechallenge of wild type SGC 7901 cells (z = 2.06-44.30, P＜0.05). The cytotoxicity of CTLs induced by SGC-7901/FB-11 cells against SGC-7901 was significantly higher than that of CTLs activated by wild-type SGC-7901 cells (84.1±2.4% vs30.5±2.3%,P＜0.05).CONCLUSION: FasL and B7-1 genes can effectively promote the activity of CTLs against gastric cancer cells. FasL/B7-1 molecules play an important role in CTL cytotoxicity.
基金This study was supported by a grant from the youth dawn program of Wuhan (Grant No. 20025001028).
文摘Objective： To construct eukaryotic expression vector containing B7-1/GFP geneand study its expression in osteosarcoma cell line LM8. Methods： By using gene cloning technique, eukaxyotic expression vector pEGFP-C1 was used to construct the murine B7-1 recombinant plasmid （pEGFP-C1/B7）. Recombinant plasmid was transfected into LM8 cells with liposome and was confirmed by restriction endonuclease digestion and DNA sequencing. The expression of the fusion protein was detected using fluorescence microscope and Western blot analysis. Results： The recombinant eukaryotic expression plasmid pEGFP-C1/B7 was successfully constructed, which was confirmed by DNA sequencing, RT-PGR and restriction enzymes analysis. The green fluorescent protein could be detected in the transfected LM8 with fluorescence microscope. The expected B7-1 and green fluorescent protein （GFP） fusion protein was detected by RT-PCR and Western blot. Conclusion： The eukaryotic expression vector containing B7-1/GFP gene was constructed successfully, and it could be expressed in LM8 after transfection.
基金by the National Key R&D Program of China(2018YFD1000200)the Fundamental Research Funds for Central Non-profit Scientific Institution+1 种基金the Agricultural Science and Technology Innovation Program,Chinese Academy of Agricultural Sciences(CAAS-ASTIP2015-RIP-04)the earmarked fund for China Agriculture Research System(CARS-29-zp)。
文摘Aroma is an important quality trait of grapes and often the focus of consumers,viticulturists and grapevine breeders.Kyoho is a hybrid between Vitis vinifera and Vitis labrusca with a strawberry-like scent,while 87-1 is an early-ripening mutant of Muscat hamburg,belonging to Vitis vinifera,with a rose scent.In this study,we compared their aroma compositions and concentrations during berry development by headspace-SPME combined with gas chromatography-mass spectrometry(GC-MS),and analyzed the expression differences of enzyme-encoding genes in the LOX-HPL,MEP and MVA metabolic pathways by qRT-PCR.Twelve esters were detected in Kyoho during the whole berry development and they were abundant after veraison,but no esters were detected in 87-1 berries.Linalool was the dominant terpene among the 14 terpenes detected in 87-1 berries,while limited amounts of terpenes were detected in Kyoho berries.qRT-PCR analysis indicated that the low expression of VvAAT might explain the low content of ester volatiles in 87-1 berries,and the low expression of coding genes in the MEP pathway,especially VvPNLin Ner1,might be the reason for the low content of volatile terpenes in Kyoho berries.The results from this work will promote our understanding of aroma metabolic mechanisms of grapes,and offer some suggestions for grape aromatic quality improvement.
基金the National Institutes of Health R21OD019934(KL)and U42OD011140(RSP)
文摘Pigs are an important resource in agriculture and serve as a model for human diseases. Due to their physiological and anatomical similarities with humans, pigs can recapitulate symptoms of human diseases, making them a useful model in biomedicine. However, in the past pig models have not been widely used partially because of the difficulty in genetic modification. The lack of true embryonic stem cells in pigs forced researchers to utilize genetic modification in somatic cells and somatic cell nuclear transfer(SCNT) to generate genetically engineered(GE) pigs carrying site-specific modifications. Although possible, this approach is extremely inefficient and GE pigs born through this method often presented developmental defects associated with the cloning process. Advancement in the gene-editing systems such as Zinc-Finger Nucleases(ZFNs), Transcription activator-like effector nucleases(TALENs), and the Clustered regularly interspaced short palindromic repeat(CRISPR)/CRISPR-associated 9(Cas9) system have dramatically increased the efficiency of producing GE pigs. These gene-editing systems, specifically engineered endonucleases, are based on inducing double-stranded breaks(DSBs) at a specific location, and then site-specific modifications can be introduced through one of the two DNA repair pathways: non-homologous end joining(NHEJ) or homology direct repair(HDR).Random insertions or deletions(indels) can be introduced through NHEJ and specific nucleotide sequences can be introduced through HDR, if donor DNA is provided. Use of these engineered endonucleases provides a higher success in genetic modifications, multiallelic modification of the genome, and an opportunity to introduce site-specific modifications during embryogenesis, thus bypassing the need of SCNT in GE pig production. This review will provide a historical prospective of GE pig production and examples of how the gene-editing system, led by engineered endonucleases, have improved GE pig production. We wil also present some of our current progress related to the optimal use of CRISPR/Cas9 system during embryogenesis.
基金supported by the National Transgenic Breeding Project, China (2008ZX08010-004)the National Natural Science Foundation of China (30830080)+1 种基金the National Basic Research Program of China (G2006CB102105, 2009CB941604)the National High Technology Research and Development Program of China (20060110Z1039, 2008AA10Z143)
文摘Polyunsaturated fatty acids （PUFAs） are essential for normal growth in mammals, especially the ω-3 PUFAs, which play important roles in preventing several life-threatening diseases, such as coronary heart disease and diabetes. In this study, we aimed to investigate whether the sFat-1 gene from Caenorhabditis briggsae could be functionally expressed in transgenic pigs, and whether the transgenic could synthesize high quality ω-3 PUFAs endogenously. In this study, a gene construct consisting of CMV promoter and 1.9 kb cDNA of ω-3 fatty acid desaturase gene （sFat-1） from C. briggsae was injected into the male pronucleus of pig embryos by microinjection. The piglets were screened for the transgene by PCR, Southern blot and reverse transcription-PCR analysis. Pigs that give positive results were mated with wild-type pigs to produce the next generation and the transmission of transgene was examined by PCR analysis. Fatty acids compositions of various tissues in the transgenic pigs were then analyzed by gas chromatograph. A total of 878 embryos were transferred into 42 recipients, among which 29 successfully got pregnant and gave birth to a total of 162 piglets, and 8 of them were identified to be transgenic. Fatty acid compositions in the transgenic pigs were altered, and the levels of ω-6：ω-3 ratios were decreased from 14.53 in the control to 2.62 in Fat-1 transgenic pigs. A number of primary sFat-1-transgenic pigs were bred in this study, which lays the foundation for cultivation of new varieties of transgenic pigs.
基金Supported by Natural Science Foundation of Hebei Province,No.012201130
文摘AIM： To study the cloning of α-β fusion gene from Closindium perfringens and the immunogenidty of 0-6 fusion expression. METHODS： Cloning was accomplished after PCR amplification from strains NCTC64609 and C58-1 of the protective antigen genes of α-toxin and β-toxin. The fragment of the gene was cloned using plasmid pZCPAB. This fragment coded for the gene with the stable expression of α-β fusion gene binding. In order to verify the exact location of the α-β fusion gene, domain plasmids were constructed. The two genes were fused into expression vector pBV221. The expressed α-β fusion protein was identified by ELISA, SDS-PAGE, Western blotting and neutralization assay. RESULTS： The protective co-toxin gene （cpa906） and the β-toxin gene （cpb930） were obtained. The recombinant plasmid pZCPAB carrying α-β fusion gene was constructed and transformed into BL21（DE3）. The recombinant strain BL21（DE3）（pZCPAB） was obtained. After the recombinant strain BL21（DE3）（pZCPAB） was induced by 42℃, its expressed product was about 22.14% of total cellular protein at SDS-PAGE and thin-layer gel scanning analysis. Neutralization assay indicated that the antibody induced by immunization with α-βfusion protein could neutralize the toxicity of α-toxin and β-toxin. CONCLUSION： The obtained α-toxin and β-toxin genes are correct. The recombinant strain BL21（DE3）（pZCPAB） could produce α-β fusion protein. This protein can be used for immunization and is immunogenic. The antibody induced by immunization with α-β fusion protein could neutralize the toxicity of α-toxin and β-toxin.
文摘Objective To study the effect of microgene pSVP oMcat implanted to modify schwann cell on growth associated protein -43(GAP -43)expression after spinal cord injury in adult rats.Method Hemisected of the T8segment of the sp inal cord was performed for all the experiment rats.The rats were randomly divided into three groups as follows:Group Awith microgene pSVPoMca t implanted to genetically modify SC;Group B with SC implanted ;Group C with hemisection of the spinal cord o nly.The changes of expression of GAP-43in spinal cord were observed by immunochemistry with antibodies against GAP -43.Simultaneous,the combined behavioral scores(CBS)was measured.Result There were not any different (P >0.05)among the three groups in first week a nd 12week.There were significant di ffeence(P <0.05)among three groups in 2nd,8th,and more dxpression of GAP -43at the 2nd week in gr oup A.The neurofunctional recovery was best in group A.Conclusion The microgene pSVPoMcat implanted t o modify schwann cell can promote the expression of GAP -43in spinal cord a nd func-tional recovery in adults rats after SCI.
文摘Keratin-associated proteins (KAPs) are a major structural component of hair and wool fibres, and play a critical role in determining the properties of the fibre. To date, forty functional high sulphur KAP genes from fourteen families have been identified in humans, but only six functional high sulphur KAP genes have been identified in sheep. This led us to search for the ovine KAP13-3 gene, a gene encoding a high sulphur KAP. In this study, the notional KAP13- 3 gene (KRTAP13-3) was amplified using primers designed based on a reported bovine KRTAP13-3 se- quence. PCR-single stranded conformational polymorphism (PCR-SSCP) analysis was used to screen amplicons derived from the gene in one hundred and forty seven New Zealand Romney crossbred sheep. Five unique banding patterns were revealed. Either one PCR-SSCP pattern (homozygous) or a combination of two patterns (heterozygous) was observed for each sheep. Sequencing of PCR amplicons representtative of different SSCP patterns revealed five different DNA sequences. The sequences derived from the amplicons showed a low homology to other known ovine KRTAPs, but had a high homology with previous reported KRTAP13-n sequences from human and cattle, with the closest homology being with bovine KRTAP13-3, suggesting the sequences represent the ovine KRTAP13-3 locus. Among the five allele sequences, four nucleotide substitutions were identified within the coding region. Of these substitutions, three were non-synonymous and would result in amino acid changes (p.Arg79Cys, p.Arg81Gln and p.Tyr130His). This variation in the KAP13-3 gene may affect gene expression, the structure and assembly of the protein, and consequently influence wool traits, if KAP13-3 is of importance to wool fibre structure.
文摘AIM: To investigate whether single-nucleotide polymor- phisms in the promoter regions of endotoxin-responsive genes CD14 C (-159) T is associated with chronic hepatitis B. METHODS: We obtained genomic DNA from 80 patients with established diagnosis of chronic hepatitis B and 126 healthy subjects served as a control population. The CD 14 C (-159) T polymorphism was investigated using an allele specific PCR method. RESULTS: Twenty seven percent of chronic hepatitis B patients and 75% of controls were heterozygous for CT genotype. The difference between the chronic hepatitis B and control groups was statistically significant [P < 0.0001; Odds ratio (OR) = 2.887; 95% CI: 1.609-5.178]. Twenty four point six percent of chronic hepatitis B and patients 12.3% of the control group were heterozygous for TT genotype. The difference between groups was not statistically significant (P = 0.256; OR = 0.658; 95% CI: 0.319-1.358). Forty eight point four percent of chronic hepatitis B patients and 12.7% of control were homozy- gote for CC genotype (P < 0.004; OR = 0.416; 95% CI: 0.229-0.755). The frequency of allele C was 61.9% and allele T was 38.1% in hepatitis B patients group. The frequency of allele C was 55.2% and allele T was 44.8% for the control group (P = 0.179; OR = 1.319; 95% CI: 0.881-1.977). CONCLUSION: The TT heterozygous genotype was not a risk factor for chronic hepatitis B. CC homozygote genotype is protective for hepatitis B. Lack of heterozy- gosis of genotype CT is a risk factor for chronic hepatitis B. Alleles C or T were not risk factors for chronic hepatitis B. These findings show the role of a single-nucleotide polymorphism at CD14/-159 on the development ofchronic hepatitis B. Endotoxin susceptibility may play a role in the pathogenesis of chronic hepatitis B.
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
基金Supported by Agricultural Science and Technology Innovation Fund of Jiangsu Province.[CX(11)2022]
文摘A 1 692 bp long chitinase-encoding ch/A gene was cloned from the genomic DNA of Serrat/a marcescens strain C8-8 by PCR, which was speculated to en- code a 563 aa long polypeptide chain with molecular weight of about 60.9 kD. Homolog analysis showed that the chiA gene sequence cloned from C8-8 shared the highest similarity with cMA sequences from Serrat/a maresscens strains 141 （ DQ 990373.1 ） and 14041 （ DQ 493896. 1 ）, which reached 99%. Domain analysis showed that N-termlnal （23 aa） of the chiA gene cloned from C8-8 harbored typical signal peptide sequence, while C-telminal harbored the other two domains, in- eluding the PKD region （73 aa） and chitinase catalytic region （387 aa）. The PCR fragment was digested with restriction endonucleases and cloned into plasmid pET28a. The recombinant plasmid pET＇28a-ch/A was firstly transformed into Escherichia coli DI-I5 , and then transformed into expression host E. coli DH3 to express ch/A gene. The recombinant strain DH3 chiA could produce transparent hydrolysis circles on the colloidal chitin plate induced by isopropyl-l-thiogalactopyranoside （IFrG）. SDS-PAGE electrophoresis analysis showed that, a protein with relative molecular weight of about 60 kD was expressed by the recombinant strain DH3 chiA, which was consistent with the except molecular weight. After initial purification, biological activity test showed that the recombinant expression product could hydrolyze chitin, which produced transparent hydrolysis circles on the colloidal chitin plates. Results indicated that chiA gene from Serrat/a marcescens strain C8-8 had biological functions and could be utilized as a potential biological control factor.
