The phylogeny of Ptychostomum was first spacer （ITS） region of the nuclear ribosomal （nr） DNA DNA rps4 sequences. Maximum parsimony, maximum undertaken based on analysis of the internal transcribed and by combinin...The phylogeny of Ptychostomum was first spacer （ITS） region of the nuclear ribosomal （nr） DNA DNA rps4 sequences. Maximum parsimony, maximum undertaken based on analysis of the internal transcribed and by combining data from nrDNA ITS and chloroplast likelihood, and Bayesian analyses all support the conclusion that the reinstated genus Ptychostomum is not monophyletic. Ptychostomum funkii （Schwagr.） J. R. Spence （≡ Bryum funkii Schwaigr.） is placed within a clade containing the type species of Bryum, B. argenteum Hedw. The remaining members of Ptychostomum investigated in the present study constitute another well-supported clade. The results are congruent with previous molecular analyses. On the basis of phylogenetic evidence, we agree with transferring B. amblyodon Mull. Hal. （≡ B. inclinatum （Brid.） Turton≡ Bryum archangelicum Bruch ＆ Schimp.）, Bryum lonchocaulon Mull. Hal., Bryum pallescens Schleich. ex Schwaigr., and Bryum pallens Sw. to Ptychostomum.展开更多
Sequence variation of the first internal transcribed spacer of ribosomal DNA （ ITS - 1 ） was examined and its application to the study of genetic variation was explored in four populations of farter＇ s scallop Chla...Sequence variation of the first internal transcribed spacer of ribosomal DNA （ ITS - 1 ） was examined and its application to the study of genetic variation was explored in four populations of farter＇ s scallop Chlamys farreri. ITS - 1 fragments, with a length of about 300 bp,of 78 individuals collected from Dalian, Qingdao, Yantai in China and Korea respectively were amplified via PCR, cloned and sequenced. Intra-genomic variation was examined by sequencing several clones of single individuals. Alignment and polymorphism analysis detected 44 haplotypes and 50 polymorphic sites which consist of 30 substitutions and 20 indels, indicating a high level of polymorphisms. Sequence analysis also showed a very low level of intra-individual variation. All these features validated the feasibility of application of ITS - 1 fragment to population analysis. Polymorphism analysis showed that the Korea sample has the richest genetic variation, followed by Yantai and Qingdao samples. AMOVA （analysis of molecular variance） showed that the majority （96.26%） of genetic variation was distributed within populations and 3.74% resulted from among populations, but with P 〈 0.05 （ = 0.042）, indicating that the populations in this study have significant divergence. This output was basically concordant with the result arising from RAPD data and different from that from mitochondrial 16S rDNA sequence data. Discussion on this inconsistency was made accordingly.展开更多
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifi cations of peritrich species and assemblages in the environment are time-consuming and experti...Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifi cations of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specifi c PCR primers were newly designed to amplify a fragment including the internal transcribed spacer(ITS) region of ribosomal rDNA from environmental samples. The primers showed high specifi city in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28 S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18 S rDNA in peritrichs. The newly designed specifi c primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in dif ferent systems.展开更多
Fungus-growing termites cultivate species of the mutualistic basidiomycete genus Termitomyces on a substrate called the fungal comb. Identification of fungal species based on morphological features is complicated, ted...Fungus-growing termites cultivate species of the mutualistic basidiomycete genus Termitomyces on a substrate called the fungal comb. Identification of fungal species based on morphological features is complicated, tedious, and prone to errors. As an alternative, nuclear ribosomal DNA sequences consisting of the internal transcribed spacers (ITS1 and ITS2) and 5.8S rDNA were used to identify Malaysian isolates of Termitomyces sp. The morphological characteristics and molecular data indicate that Malaysian Termitomyces isolated is clearly monophyletic and belongs to the Tricholomataceae family. The Malaysian isolates analyzed in this study represent the termite fungus species called T. aurantiacus.展开更多
Wax gourd (Benincasa hispida Thumb. Cogn) is called white gourd, winter melon, Chinese preserving melon, Chinese squash, and don kwa. It has been cultivated in China for over 2 300 years. It probably
Ricinus communis have attracted considerable attention because of its specific industrial and pharmacological activities. DNA barcodes can be used as reliable tools to facilitate the identification of medicinal plants...Ricinus communis have attracted considerable attention because of its specific industrial and pharmacological activities. DNA barcodes can be used as reliable tools to facilitate the identification of medicinal plants for the safe use, quality control and forensic investigation. In this study, the differential identification of eight accessions of R. com-munis was investigated through DNA sequence analysis of two candidate DNA barcodes. The nucleotide sequence of internal transcribed spacers (ITS2) and chloroplast maturase gene (matK) have been determined to construct the phylogenetic tree. The phylogenetic relationships of accessions based on the nrITS2 region and partial matK region showed that all accessions in this study were related to three geographical origins. Based on sequence align-ment and phylogenetic analyses we concluded that the ITS2 sequences can distinguish R. communis accessions from different geographical distributions.展开更多
In order to analyze the sequences of the internal transcribed spacer （ITS） including the 5.8 S ribosomal DNA （rDNA） of common dermatophytes, so as to obtain a rapid and accurate method to identify the species of d...In order to analyze the sequences of the internal transcribed spacer （ITS） including the 5.8 S ribosomal DNA （rDNA） of common dermatophytes, so as to obtain a rapid and accurate method to identify the species of dermatophytes and to establish the phylogenetic tree of these species to understand their relationship, 16 strains of dermatophytes were collected and preliminarily identified by morphological characteristics. General primers for fungi ITS1 and ITS4 were used to amplify the ITS rDNA of each strains with PCR. The PCR products after purification were sequenced directly and were analyzed through internet. In the results, 11 strains were identified by means of morphological features, among which 5 strains were Trichophyton, 5 strains were Microsporum and 1 was Epidermophytoa, which was consistent with the results by molecular biology. In the 5 unidentifiable strains, 1 strain was proved to be Chrysosporium by molecular biology. These strains studied could be divided into 3 different classes as indicated in the analysis of the phylogenetic tree of the sequences in ITS, which were quite different from those of morphological classification. It is evident from the above observations that the molecular method of analysis on the ITS sequences is a rapid, highly sensitive and accurate approach for the detection of dematophyte species, however, it still exhibits some limitations needing the supplementation with morphological identification.展开更多
To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplifi...To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.展开更多
Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as micr...Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.展开更多
Shankhpushpi is a reputed drug from an Indian system of medicine for treating mental disorders and enhancing memory. Two herbs, namely Convolvulus prostratus Forssk. and Evolvulus alsinoides(L.) L., are commonly known...Shankhpushpi is a reputed drug from an Indian system of medicine for treating mental disorders and enhancing memory. Two herbs, namely Convolvulus prostratus Forssk. and Evolvulus alsinoides(L.) L., are commonly known as Shankhpushpi. Ambiguous vernacular identity can affect the scientific validity of the Shankpushpi-based herbal drug therapy. In the present investigation, a novel and sensitive multiplex PCR method based on polymorphism in the internal transcribed spacer(ITS) region was developed to establish the molecular identity of C. prostratus and E. alsinoides. DNA was isolated and the ITS region was amplified, sequenced and assembled. Sequences were aligned to identify variable nucleotides in order to develop plant-specific primers. Primers were validated in singleplex reactions and eventually a multiplex assay was developed. This assay was tested for sensitivity and validated by amplifying DNA isolated from the simulated blended powdered plant material. Primers developed for C. prostratus resulted into a 200 bp amplicon and 596 bp for E. alsinoides. The assay was found to be sensitive enough for amplification of low quantities of DNA. The method can detect 10% of the mixing of plants with each other in blended material. This PCR assay can be used for rapid botanical identification of Shankhpushpi plant materials and will improve evidence-based herbal drug therapy.展开更多
Phylogenetic relationships of Arundinaria and related genera (Pleioblastus, Pseudosasa, Oligostachyum, Bashania, Clavinodum, etc.) were assessed by analyzing the sequences of the nrDNA internal transcribed spacer (ITS...Phylogenetic relationships of Arundinaria and related genera (Pleioblastus, Pseudosasa, Oligostachyum, Bashania, Clavinodum, etc.) were assessed by analyzing the sequences of the nrDNA internal transcribed spacer (ITS) and the cpDNA trnL-F intergenic spacer (IGS). Comparison with trnL-F IGS sequence, the ITS region provided the higher number of parsimony informative characters, and the interspecific variation of the ITS sequence was higher than that of the trnL-F IGS sequence.The tree obtained by combining both sets of data showed that the species sampled in Arundinaria and the related genera were monophyletic and divided into two clades. The relationships and positioning of all the taxa surveryed (including A. oleosa, A. hsienchuensis, A. chino, A. amara, A. yixingensis, A. amabilis, A. fortunei, A. pygmaea, A. gramineus, A. fargesii, A. faberi, A. hupehense, Pseudosasa japonica cv. Tsutsumiana, P. japonica and Brachystachyum densiflorum) were also discussed. The results from the sequences were broadly consistent with morphological characters, appearing all these taxa sampled belong to the genus of Arundinaria. The topologies of the trees generated from individual data and the combined data were similar.展开更多
基金supported by the National Natural Science Foundation of China(grantno.30670152)the National Infrastructure of Natural Resources for Science and Technology(grant no.2005DKA21403)the Natural Science Foundation of Hebei Province,China(no.C2008000158)
文摘The phylogeny of Ptychostomum was first spacer （ITS） region of the nuclear ribosomal （nr） DNA DNA rps4 sequences. Maximum parsimony, maximum undertaken based on analysis of the internal transcribed and by combining data from nrDNA ITS and chloroplast likelihood, and Bayesian analyses all support the conclusion that the reinstated genus Ptychostomum is not monophyletic. Ptychostomum funkii （Schwagr.） J. R. Spence （≡ Bryum funkii Schwaigr.） is placed within a clade containing the type species of Bryum, B. argenteum Hedw. The remaining members of Ptychostomum investigated in the present study constitute another well-supported clade. The results are congruent with previous molecular analyses. On the basis of phylogenetic evidence, we agree with transferring B. amblyodon Mull. Hal. （≡ B. inclinatum （Brid.） Turton≡ Bryum archangelicum Bruch ＆ Schimp.）, Bryum lonchocaulon Mull. Hal., Bryum pallescens Schleich. ex Schwaigr., and Bryum pallens Sw. to Ptychostomum.
基金This work was financially supported by the"863"Project of China under contract No.2002AA626020the National Nalural Science Foundation of China under contract No.30570242.
文摘Sequence variation of the first internal transcribed spacer of ribosomal DNA （ ITS - 1 ） was examined and its application to the study of genetic variation was explored in four populations of farter＇ s scallop Chlamys farreri. ITS - 1 fragments, with a length of about 300 bp,of 78 individuals collected from Dalian, Qingdao, Yantai in China and Korea respectively were amplified via PCR, cloned and sequenced. Intra-genomic variation was examined by sequencing several clones of single individuals. Alignment and polymorphism analysis detected 44 haplotypes and 50 polymorphic sites which consist of 30 substitutions and 20 indels, indicating a high level of polymorphisms. Sequence analysis also showed a very low level of intra-individual variation. All these features validated the feasibility of application of ITS - 1 fragment to population analysis. Polymorphism analysis showed that the Korea sample has the richest genetic variation, followed by Yantai and Qingdao samples. AMOVA （analysis of molecular variance） showed that the majority （96.26%） of genetic variation was distributed within populations and 3.74% resulted from among populations, but with P 〈 0.05 （ = 0.042）, indicating that the populations in this study have significant divergence. This output was basically concordant with the result arising from RAPD data and different from that from mitochondrial 16S rDNA sequence data. Discussion on this inconsistency was made accordingly.
基金Supported by the National Natural Science Foundation of China(Nos.31572255,41522604,31301867)the Strategic Priority Research Program of CAS(No.XDA11020702)the Science and Technology Development Program of Yantai(No.2014ZH073)
文摘Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifi cations of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specifi c PCR primers were newly designed to amplify a fragment including the internal transcribed spacer(ITS) region of ribosomal rDNA from environmental samples. The primers showed high specifi city in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28 S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18 S rDNA in peritrichs. The newly designed specifi c primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in dif ferent systems.
文摘Fungus-growing termites cultivate species of the mutualistic basidiomycete genus Termitomyces on a substrate called the fungal comb. Identification of fungal species based on morphological features is complicated, tedious, and prone to errors. As an alternative, nuclear ribosomal DNA sequences consisting of the internal transcribed spacers (ITS1 and ITS2) and 5.8S rDNA were used to identify Malaysian isolates of Termitomyces sp. The morphological characteristics and molecular data indicate that Malaysian Termitomyces isolated is clearly monophyletic and belongs to the Tricholomataceae family. The Malaysian isolates analyzed in this study represent the termite fungus species called T. aurantiacus.
文摘Wax gourd (Benincasa hispida Thumb. Cogn) is called white gourd, winter melon, Chinese preserving melon, Chinese squash, and don kwa. It has been cultivated in China for over 2 300 years. It probably
文摘Ricinus communis have attracted considerable attention because of its specific industrial and pharmacological activities. DNA barcodes can be used as reliable tools to facilitate the identification of medicinal plants for the safe use, quality control and forensic investigation. In this study, the differential identification of eight accessions of R. com-munis was investigated through DNA sequence analysis of two candidate DNA barcodes. The nucleotide sequence of internal transcribed spacers (ITS2) and chloroplast maturase gene (matK) have been determined to construct the phylogenetic tree. The phylogenetic relationships of accessions based on the nrITS2 region and partial matK region showed that all accessions in this study were related to three geographical origins. Based on sequence align-ment and phylogenetic analyses we concluded that the ITS2 sequences can distinguish R. communis accessions from different geographical distributions.
文摘In order to analyze the sequences of the internal transcribed spacer （ITS） including the 5.8 S ribosomal DNA （rDNA） of common dermatophytes, so as to obtain a rapid and accurate method to identify the species of dermatophytes and to establish the phylogenetic tree of these species to understand their relationship, 16 strains of dermatophytes were collected and preliminarily identified by morphological characteristics. General primers for fungi ITS1 and ITS4 were used to amplify the ITS rDNA of each strains with PCR. The PCR products after purification were sequenced directly and were analyzed through internet. In the results, 11 strains were identified by means of morphological features, among which 5 strains were Trichophyton, 5 strains were Microsporum and 1 was Epidermophytoa, which was consistent with the results by molecular biology. In the 5 unidentifiable strains, 1 strain was proved to be Chrysosporium by molecular biology. These strains studied could be divided into 3 different classes as indicated in the analysis of the phylogenetic tree of the sequences in ITS, which were quite different from those of morphological classification. It is evident from the above observations that the molecular method of analysis on the ITS sequences is a rapid, highly sensitive and accurate approach for the detection of dematophyte species, however, it still exhibits some limitations needing the supplementation with morphological identification.
基金Supported by the Natural Science Foundation of Beijing, China (Grant No. 7052009)the National Natural Science Foundation of China (Grant No. 30470243)
文摘To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.
文摘Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
基金University Grant Commission,New Delhi (India) for financial support (Award letter No.20-12/2009(ii) EU-IV)
文摘Shankhpushpi is a reputed drug from an Indian system of medicine for treating mental disorders and enhancing memory. Two herbs, namely Convolvulus prostratus Forssk. and Evolvulus alsinoides(L.) L., are commonly known as Shankhpushpi. Ambiguous vernacular identity can affect the scientific validity of the Shankpushpi-based herbal drug therapy. In the present investigation, a novel and sensitive multiplex PCR method based on polymorphism in the internal transcribed spacer(ITS) region was developed to establish the molecular identity of C. prostratus and E. alsinoides. DNA was isolated and the ITS region was amplified, sequenced and assembled. Sequences were aligned to identify variable nucleotides in order to develop plant-specific primers. Primers were validated in singleplex reactions and eventually a multiplex assay was developed. This assay was tested for sensitivity and validated by amplifying DNA isolated from the simulated blended powdered plant material. Primers developed for C. prostratus resulted into a 200 bp amplicon and 596 bp for E. alsinoides. The assay was found to be sensitive enough for amplification of low quantities of DNA. The method can detect 10% of the mixing of plants with each other in blended material. This PCR assay can be used for rapid botanical identification of Shankhpushpi plant materials and will improve evidence-based herbal drug therapy.
文摘Phylogenetic relationships of Arundinaria and related genera (Pleioblastus, Pseudosasa, Oligostachyum, Bashania, Clavinodum, etc.) were assessed by analyzing the sequences of the nrDNA internal transcribed spacer (ITS) and the cpDNA trnL-F intergenic spacer (IGS). Comparison with trnL-F IGS sequence, the ITS region provided the higher number of parsimony informative characters, and the interspecific variation of the ITS sequence was higher than that of the trnL-F IGS sequence.The tree obtained by combining both sets of data showed that the species sampled in Arundinaria and the related genera were monophyletic and divided into two clades. The relationships and positioning of all the taxa surveryed (including A. oleosa, A. hsienchuensis, A. chino, A. amara, A. yixingensis, A. amabilis, A. fortunei, A. pygmaea, A. gramineus, A. fargesii, A. faberi, A. hupehense, Pseudosasa japonica cv. Tsutsumiana, P. japonica and Brachystachyum densiflorum) were also discussed. The results from the sequences were broadly consistent with morphological characters, appearing all these taxa sampled belong to the genus of Arundinaria. The topologies of the trees generated from individual data and the combined data were similar.
