Cancer immunotherapy has emerged as a promising strategy for the treatment of cancer,with the tumor microenvironment(TME)playing a pivotal role in modulating the immune response.CD47,a cell surface protein,has been id...Cancer immunotherapy has emerged as a promising strategy for the treatment of cancer,with the tumor microenvironment(TME)playing a pivotal role in modulating the immune response.CD47,a cell surface protein,has been identified as a crucial regulator of the TME and a potential therapeutic target for cancer therapy.However,the precise functions and implications of CD47 in the TME during immunotherapy for cancer patients remain incompletely understood.This comprehensive review aims to provide an overview of CD47’s multifaced role in TME regulation and immune evasion,elucidating its impact on various types of immunotherapy outcomes,including checkpoint inhibitors and CAR T-cell therapy.Notably,CD47-targeted therapies offer a promising avenue for improving cancer treatment outcomes,especially when combined with other immunotherapeutic approaches.The review also discusses current and potential CD47-targeted therapies being explored for cancer treatment and delves into the associated challenges and opportunities inherent in targeting CD47.Despite the demonstrated effectiveness of CD47-targeted therapies,there are potential problems,including unintended effects on healthy cells,hematological toxicities,and the development if resistance.Consequently,further research efforts are warranted to fully understand the underlying mechanisms of resistance and to optimize CD47-targeted therapies through innovative combination approaches,ultimately improving cancer treatment outcomes.Overall,this comprehensive review highlights the significance of CD47 as a promising target for cancer immunotherapy and provides valuable insight into the challenges and opportunities in developing effective CD47-targeted therapies for cancer treatment.展开更多
In addition toβ-cell failure with inadequate insulin secretion,the crucial mechanism leading to establishment of diabetes mellitus(DM)is the resistance of target cells to insulin,i.e.insulin resistance(IR),indicating...In addition toβ-cell failure with inadequate insulin secretion,the crucial mechanism leading to establishment of diabetes mellitus(DM)is the resistance of target cells to insulin,i.e.insulin resistance(IR),indicating a requirement of beyond-normal insulin concentrations to maintain euglycemic status and an ineffective strength of transduction signaling from the receptor,downstream to the substrates of insulin action.IR is a common feature of most metabolic disorders,particularly type II DM as well as some cases of type I DM.A variety of human inammatory disorders with increased levels of proinflammatory cytokines,including tumor necrosis factor(TNF)-α,interleukin(IL)-6 and IL-1β,have been reported to be associated with an increased risk of IR.Autoimmunemediated arthritis conditions,including rheumatoid arthritis(RA),psoriatic arthritis(PsA)and ankylosing spondylitis(AS),with the involvement of proinflammatory cytokines as their central pathogenesis,have been demonstrated to be associated with IR,especially during the active disease state.There is an increasing trend towards using biologic agents and small molecule-targeted drugs to treat such disorders.In this review,we focus on the effects of anti-TNF-α-and non-TNF-α-targeted therapies on IR in patients with RA,PsA and AS.Anti-TNF-αtherapy,IL-1 blockade,IL-6 antagonist,Janus kinase inhibitor and phosphodiesterase type 4 blocker can reduce IR and improve diabetic hyper-glycemia in autoimmune-mediated arthritis.展开更多
Background:Ultrasound-targeted microbubble destruction(UTMD)induces cellular inflow of drugs at low intensity,while high intensity eradicates tumor vessels.Since vascular endothelial growth factor receptor 2(VEGFR2)is...Background:Ultrasound-targeted microbubble destruction(UTMD)induces cellular inflow of drugs at low intensity,while high intensity eradicates tumor vessels.Since vascular endothelial growth factor receptor 2(VEGFR2)is highly expressed in pancreatic ductal adenocarcinoma(PDAC),VEGFR2-targeted microbubble(MB)might additionally increase the tissue specificity of drugs and thus improve antitumor effects.In addition,fixing the dual pulse intensity could maximize MB properties.This study evaluated the one-off(experiment 1)and cumulative(experiment 2)treatment effect of UTMD by regulating the dual pulse output applied to PDAC using VEGFR2-targeted MB.Methods:C57BL/6 mice inoculated with Pan-02 cells were allocated to five groups:VEGFR2-targeted MB+gemcitabine(GEM),VEGFR2-targeted MB,non-targeted MB+GEM,GEM,and control groups.After injection of GEM or GEM and either VEGFR2-targeted or non-targeted MB,UTMD was applied for several minutes at low intensity followed by high intensity application.In experiment 1,mice were treated by the protocol described above and then euthanized immediately or at the tumor diameter doubling time(TDT).In experiment 2,the same protocol was repeated weekly and mice were euthanized at TDT regardless of protocol completion.Histological analysis by CD31 and VEGFR2 staining provided microvascular density(MVD)and VEGFR2 expression along vessels(VEGFR2v)or intra/peripheral cells(VEGFR2c).Results:In experiment 1,TDT was significantly longer in the VEGFR2-targeted MB+GEM group compared to the non-targeted MB+GEM,GEM,and control groups,while the VEGFR2-targeted MB group showed no statistical significance.MVD and VEGFR2v in the immediate euthanasia was significantly lower in the VEGFR2-targeted MB+GEM and VEGFR2-targeted MB groups than other conditions.In experiment 2,the VEGFR2-targeted MB+GEM group produced significantly longer TDT than the GEM or control groups,whereas the VEGFR2-targeted MB group showed no significant difference.Histology revealed significantly reduced VEGFR2v and VEGFR2c in the VEGFR2-targeted and non-targeted MB+GEM groups,while only VEGFR2v was significantly less in the VEGFR2-targeted MB group.Conclusions:UTMD-mediated GEM therapy with the dual pulse application using VEGFR2-targeted MB substantially suppresses PDCA growth.展开更多
[ Objective] The study aimed to supply important basis for developing environment-friendly pesticides with myricetin and crude extract of Myrica rubra leaves as effective components. [ Method] According to ＂Test guid...[ Objective] The study aimed to supply important basis for developing environment-friendly pesticides with myricetin and crude extract of Myrica rubra leaves as effective components. [ Method] According to ＂Test guidelines for environmental safety evaluation on chemical pesticides＂, the toxicity of myricetin and crude extract of M. rubra leaves on non-target organisms was determined and the safety evaluation was carried out. [Result] MyriceUn and crude extract of M. rubra leaves had low toxicity on non-target organisms, such as earthworm, silkworm and soil microbes. Myricetin showed low toxicity and the crude extract of M. rubra leaves showed middle toxicity on tadpole. The high-concentration crude extract of M. rubra leaves had some antifeedant effect on silkworm. [ Conclusion] Myricetin and crude extract of M. rubra leaves had low toxicity on non-tar- get organisms in environment and they were relatively safe.展开更多
Leukemia relapse is still the leading cause of treatment failure after allogeneic hematopoietic stem cell transplantation (allo-HSCT) for B cell acute lymphoblastic leukemia (B-ALL). Relapsed patients with BALL after ...Leukemia relapse is still the leading cause of treatment failure after allogeneic hematopoietic stem cell transplantation (allo-HSCT) for B cell acute lymphoblastic leukemia (B-ALL). Relapsed patients with BALL after allo-HSCT have a very short median survival. Minimal residual disease (MRD) is predictive of forthcoming hematological relapse after hematopoietic stem cell transplantation (HSCT);furthermore, eliminating MRD effectively prevents relapse. Donor lymphoblastic infusion (DLI) is the main established approach to treat B-ALL with MRD after allo-HSCT. However, about one-third of patients with MRD are non-responsive to DLI and their prognosis worsens. Although donor-derived cluster of differentiation (CD)19-directed chimeric antigen receptor-modified (CAR) T cells (CART19s) can potentially cure leukemia, the efficiency and safety of infusions with these cells have not yet been investigated in patients with MRD after HSCT. Between September 2014 and February 2018, six patients each received one or more infusions of CART19s from HSCT donors. Five (83.33%) achieved MRD-negative remission, and one case was not responsive to the administration of CAR T cells. Three of the six patients are currently alive without leukemia. No patient developed acute graft-versus-host disease (aGVHD), and no patient died of cytokine release syndrome. Donor-derived CAR T cell infusions seem to be an effective and safe intervention for patients with MRD in B-ALL after allo-HSCT and for those who were not responsive to DLI.展开更多
The basic concepts and models of weapon-target assignment （WTA） are introduced and the mathematical nature of the WTA models is also analyzed. A systematic survey of research on WTA problem is provided. The present ...The basic concepts and models of weapon-target assignment （WTA） are introduced and the mathematical nature of the WTA models is also analyzed. A systematic survey of research on WTA problem is provided. The present research on WTA is focused on models and algorithms. In the research on models of WTA, the static WTA models are mainly studied and the dynamic WTA models are not fully studied in deed. In the research on algorithms of WTA, the intelligent algorithms are often used to solve the WTA problem. The small scale of static WTA problems has been solved very well, however, the large scale of dynamic WTA problems has not been solved effectively so far. Finally, the characteristics of dynamic WTA are analyzed and directions for the future research on dynamic WTA are discussed.展开更多
Transgenic insect-resistant cotton is being increasingly planted in Xinjiang cotton-planting regions, where geographical climate conditions and species composition of pests and natural enemies are greatly unique in Ch...Transgenic insect-resistant cotton is being increasingly planted in Xinjiang cotton-planting regions, where geographical climate conditions and species composition of pests and natural enemies are greatly unique in China. Limited studies have been conducted on the ecological impacts of transgenic insect-resistant cotton, especially for transgenic double genes （Bt＋CpTI） cotton, in this region. In this study, the potential effects of transgenic Bt＋CpTI cotton on the seasonal abundance of non-target pests and predators were assessed from 2009 to 2011 in Korla, Xinjiang. The results showed that species composition and seasonal abundance of 5 groups of pests and 5 groups of predators were not significantly different between transgenic Bt＋CpTI cotton and non-transgenic cotton every year. It suggests that transgenic Bt＋CpTI cotton per se does not affect the population dynamics of non-target pests and predators on this crop in Xinjiang.展开更多
"Vasculogenic mimicry(VM)",is a term that describes the unique ability of highly aggressive tumor cells to express a multipotent,stem cell-like phenotype,and form a pattern of vasculogenic-like networks in t..."Vasculogenic mimicry(VM)",is a term that describes the unique ability of highly aggressive tumor cells to express a multipotent,stem cell-like phenotype,and form a pattern of vasculogenic-like networks in threedimensional culture.As an angiogenesis-independent pathway,VM and/or periodic acid-schiff-positive patterns are associated with poor prognosis in tumor patients.Moreover,VM is resistant to angiogenesis inhibitors.Here,we will review the advances in research on biochemical and molecular signaling pathways of VM in tumors and on potential anti-VM therapy strategy.展开更多
The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the o...The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.展开更多
OBJECTIVE Numerous references made clear that triphala is revered as a multiuse therapeutic and perhaps even panacea historically.Nevertheless,the protective mechanism of triphala on cardio-cerebral vascular diseases(...OBJECTIVE Numerous references made clear that triphala is revered as a multiuse therapeutic and perhaps even panacea historically.Nevertheless,the protective mechanism of triphala on cardio-cerebral vascular diseases(CCVDs)remains not comprehensive understanding.Hence,a network pharmacology-based method was suggested in this study to address this problem.METHODS This study was based on network pharmacology and bioinformatics analysis.Information on compounds in herbal medicines of triphala formula was acquired from public databases.Oral bioavailability as well as drug-likeness were screened by using absorption,distribution,metabolism,and excretion(ADME)criteria.Then,components of triphala,candidate targets of each component and known therapeutic targets of CCVDs were collected.Compound-target gene and compounds-CCVDs target networks were created through network pharmacology data sources.In addition,key targets and pathway enrichment were analyzed by STRING database and DAVID database.Moreover,we verified three of the key targets(PTGS2,MMP9 and IL-6)predicted by using Western blotting analysis.RESULTS Network analysis determined 132 compounds in three herbal medicines that were subjected to ADME screening,and 23 compounds as well as 65 genes formed the principal pathways linked to CCVDs.And 10 compounds,which actually linked to more than three genes,are determined as crucial chemicals.Core genes in this network were IL-6,TNF,VEGFA,PTGS2,CXCL8,TP53,CCL2,IL-10,MMP9 and SERPINE1.And pathways in cancer,TNF signaling path⁃way,neuroactive ligand-receptor interaction,etc.related to CCVDs were identified.In vitro experiments,the results indi⁃cated that compared with the control group(no treatment),PTGS2,MMP9 and IL-6 were up-regulated by treatment of 10μg·L^-1 TNF-α,while pretreatment with 20-80 mg·L^-1 triphala could significantly inhibit the expression of PTGS2,MMP9 and IL-6.With increasing Triphala concentration,the expression of PTGS2,MMP9 and IL-6 decreased.CON⁃CLUSION Complex components and pharmacological mechanism of triphala,and obtained some potential therapeutic targets of CCVDs,which could provide theoretical basis for the research and development of new drugs for treating CCVDs.展开更多
A novel data association algorithm is developed based on fuzzy geneticalgorithms (FGAs). The static part of data association uses one FGA to determine both the lists ofcomposite measurements and the solutions of m-bes...A novel data association algorithm is developed based on fuzzy geneticalgorithms (FGAs). The static part of data association uses one FGA to determine both the lists ofcomposite measurements and the solutions of m-best S-D assignment. In the dynamic part of dataassociation, the results of the m-best S-D assignment are then used in turn, with a Kalman filterstate estimator, in a multi-population FGA-based dynamic 2D assignment algorithm to estimate thestates of the moving targets over time. Such an assignment-based data association algorithm isdemonstrated on a simulated passive sensor track formation and maintenance problem. The simulationresults show its feasibility in multi-sensor multi-target tracking. Moreover, algorithm developmentand real-time problems are briefly discussed.展开更多
A decision-making problem of missile-target assignment with a novel particle swarm optimization algorithm is proposed when it comes to a multiple target collaborative combat situation.The threat function is establishe...A decision-making problem of missile-target assignment with a novel particle swarm optimization algorithm is proposed when it comes to a multiple target collaborative combat situation.The threat function is established to describe air combat situation.Optimization function is used to find an optimal missile-target assignment.An improved particle swarm optimization algorithm is utilized to figure out the optimization function with less parameters,which is based on the adaptive random learning approach.According to the coordinated attack tactics,there are some adjustments to the assignment.Simulation example results show that it is an effective algorithm to handle with the decision-making problem of the missile-target assignment(MTA)in air combat.展开更多
In this study, we examined the effects of neuroglobin gene （Ngb） transfection into SH-SY5Y cells, using ultrasound-targeted microbubble destruction （UTMD）, on cobalt chloride-induced hypoxia. With an ultrasound in...In this study, we examined the effects of neuroglobin gene （Ngb） transfection into SH-SY5Y cells, using ultrasound-targeted microbubble destruction （UTMD）, on cobalt chloride-induced hypoxia. With an ultrasound intensity of 0.8 W/cm2, a 60-second exposure duration, 50% duty cycle, and 20% microbubble concentration, pAcGFP1-C1-Ngb-transfected cells exhibited the highest cell viability and transfection efficiency. The efficiency of plasmid delivery was significantly higher with UTMD than transfection with plasmid alone, transfection with plasmid using microbubbles, or transfection of plasmid by ultrasound. In addition, during cobalt chloride-induced hypoxia, caspase-3 activity in pAcGFP1-C1-Ngb-transfected cells was significantly lower than in untransfected cells. Ngb protein and mRNA expression were significantly higher in cells transfected by UTMD than in cells transfected with the other methods. These results demonstrate that UTMD can very efficiently mediate exogenous gene delivery, and that Ngb overexpression protects cells against cobalt chloride-induced hypoxia.展开更多
American sloughgrass(Beckmannia syzigachne(Steud.) Fernald) is one of the most competitive and malignant weeds in rice-wheat rotation fields in China. American sloughgrass populations in the Jiangsu Province of China ...American sloughgrass(Beckmannia syzigachne(Steud.) Fernald) is one of the most competitive and malignant weeds in rice-wheat rotation fields in China. American sloughgrass populations in the Jiangsu Province of China became less sensitive to acetohydroxyacid synthase(AHAS) inhibitors after repeated application for many years in these areas. Two suspected resistant American sloughgrass populations(R1 and R2) collected in the field were detected the resistance to inhibitors of AHAS in whole-plant dose-response assays, compared to the susceptible(S) population. These assays indicated that R1 showed low resistance to mesosulfuron-methyl(3.32-fold), imazapic(2.84-fold) and pyroxsulam(1.55-fold), moderate resistance to flazasulfuron(4.67-fold) and pyribenzoxim(7.41-fold), and high resistance to flucarbazone(11.73-fold). However, using a combination of the cytochrome P450 inhibitor, malathion, with mesosulfuron-methyl resulted in a reduction in R1 resistance relative to mesosulfuron-methyl alone. Furthermore, R2 was highly resistant to flazasulfuron(34.90-fold), imazapic(11.30-fold), flucarbazone(49.20-fold), pyribenzoxim(12.94-fold), moderately resistant to mesosulfuron-methyl(9.77-fold) and pyroxsulam(6.26-fold), and malathion had no effect on R2 resistance to mesosulfuron-methyl. The fulllength of AHAS genes was sequenced and the AHAS enzymes were assayed in vitro in order to clarify the mechanism of resistance to AHAS inhibitors in R1 and R2 populations. The results demonstrated that R2 had a Pro-197-Ser mutation in the AHAS gene, and the sensitivity of R2 to the five AHAS inhibitors was decreased, which may result in R2 resistance to AHAS inhibitors. There was no mutation in the AHAS gene of R1, and there were no significant differences in enzyme sensitivity between susceptible(S) and resistant(R1) populations. An enhanced metabolism may be the main mechanism of R1 resistance to AHAS inhibitors.展开更多
Much research mainly focuses on the batch processing method （e.g. maximum likelihood method） when bearings-only multiple targets tracking of bistatic sonar system is considered. In this paper, the idea of recursive ...Much research mainly focuses on the batch processing method （e.g. maximum likelihood method） when bearings-only multiple targets tracking of bistatic sonar system is considered. In this paper, the idea of recursive processing method is presented and employed, and corresponding data association algorithms, i.e. a multi-objective ant-colony-based optimization algorithm and an easy fast assignment algorithm are developed to solve the measurements-to-measurements and measurements-to-tracks data association problems of bistatic sonar system, respectively. Monte-Carlo simulations are induced to evaluate the effectiveness of the proposed methods.展开更多
This paper proposed a robust method based on the definition of Mahalanobis distance to track ground moving target. The feature and the geometry of airborne ground moving target tracking systems are studied at first. B...This paper proposed a robust method based on the definition of Mahalanobis distance to track ground moving target. The feature and the geometry of airborne ground moving target tracking systems are studied at first. Based on this feature, the assignment relation of time-nearby target is calculated via Mahalanobis distance, and then the corresponding transformation formula is deduced. The simulation results show the correctness and effectiveness of the proposed method.展开更多
BACKGROUND Crohn’s disease(CD)can affect the entire gastrointestinal tract.Proximal small bowel(SB)lesions are associated with a significant risk of stricturing disease and multiple abdominal surgeries.The assessment...BACKGROUND Crohn’s disease(CD)can affect the entire gastrointestinal tract.Proximal small bowel(SB)lesions are associated with a significant risk of stricturing disease and multiple abdominal surgeries.The assessment of SB in patients with CD is therefore necessary because it may have a significant impact on prognosis with potential therapeutic implications.Because of the weak correlation that exists between symptoms and endoscopic disease activity,the“treat-to-target”paradigm has been developed,and the associated treatment goal is to achieve and maintain deep remission,encompassing both clinical and endoscopic remission.Small bowel capsule endoscopy(SBCE)allows to visualize the mucosal surface of the entire SB.At that time,there is no recommendation regarding the use of SBCE during follow-up.AIM To investigate the impact of SBCE in a treat-to-target strategy in patients with CD.METHODS An electronic literature search was conducted in PubMed and Cochrane library using the following search terms:“capsule endoscopy”,in combination with“Crohn’s disease”and“treat-to-target”or synonyms.Two authors independently reviewed titles and abstracts identified by the search strategy after duplicates were removed.Following the initial screening of abstracts,all articles containing information about SBCE in the context of treat-to-target strategy in patients with CD were included.Full-text articles were retrieved,reference lists were screened manually to identify additional studies.RESULTS Forty-seven articles were included in this review.Two indexes are currently used to quantify disease activity using SBCE,and there is good correlation between them.SBCE was shown to be useful for disease reclassification in patients who are suspected of having or who are diagnosed with CD,with a significant incremental diagnostic yield compared to other diagnostic modalities.Nine studies also demonstrated that the mucosal healing can be evaluated by SBCE to monitor the effect of medical treatment in patients with CD.This review also demonstrated that SBCE can detect post-operative recurrence to a similar extent as ileocolonoscopy,and proximal SB lesions that are beyond the reach of the colonoscope in over half of the patients.CONCLUSION SBCE could be incorporated in the treat-to-target algorithm for patients with CD.Randomized controlled trials are required to confirm its usefulness and reliability in this indication.展开更多
基金the Huzhou Science and Technology Bureau,Zhejiang Province,China(2020GZ41).
文摘Cancer immunotherapy has emerged as a promising strategy for the treatment of cancer,with the tumor microenvironment(TME)playing a pivotal role in modulating the immune response.CD47,a cell surface protein,has been identified as a crucial regulator of the TME and a potential therapeutic target for cancer therapy.However,the precise functions and implications of CD47 in the TME during immunotherapy for cancer patients remain incompletely understood.This comprehensive review aims to provide an overview of CD47’s multifaced role in TME regulation and immune evasion,elucidating its impact on various types of immunotherapy outcomes,including checkpoint inhibitors and CAR T-cell therapy.Notably,CD47-targeted therapies offer a promising avenue for improving cancer treatment outcomes,especially when combined with other immunotherapeutic approaches.The review also discusses current and potential CD47-targeted therapies being explored for cancer treatment and delves into the associated challenges and opportunities inherent in targeting CD47.Despite the demonstrated effectiveness of CD47-targeted therapies,there are potential problems,including unintended effects on healthy cells,hematological toxicities,and the development if resistance.Consequently,further research efforts are warranted to fully understand the underlying mechanisms of resistance and to optimize CD47-targeted therapies through innovative combination approaches,ultimately improving cancer treatment outcomes.Overall,this comprehensive review highlights the significance of CD47 as a promising target for cancer immunotherapy and provides valuable insight into the challenges and opportunities in developing effective CD47-targeted therapies for cancer treatment.
基金The authors are indebted to the physicians and nurses involved in the diagnosis and management of patients reported from the National Cheng Kung University Hospital(NCKUH).The Institutional Review Board of NCKUH approved this study(No.B-ER105-108).
文摘In addition toβ-cell failure with inadequate insulin secretion,the crucial mechanism leading to establishment of diabetes mellitus(DM)is the resistance of target cells to insulin,i.e.insulin resistance(IR),indicating a requirement of beyond-normal insulin concentrations to maintain euglycemic status and an ineffective strength of transduction signaling from the receptor,downstream to the substrates of insulin action.IR is a common feature of most metabolic disorders,particularly type II DM as well as some cases of type I DM.A variety of human inammatory disorders with increased levels of proinflammatory cytokines,including tumor necrosis factor(TNF)-α,interleukin(IL)-6 and IL-1β,have been reported to be associated with an increased risk of IR.Autoimmunemediated arthritis conditions,including rheumatoid arthritis(RA),psoriatic arthritis(PsA)and ankylosing spondylitis(AS),with the involvement of proinflammatory cytokines as their central pathogenesis,have been demonstrated to be associated with IR,especially during the active disease state.There is an increasing trend towards using biologic agents and small molecule-targeted drugs to treat such disorders.In this review,we focus on the effects of anti-TNF-α-and non-TNF-α-targeted therapies on IR in patients with RA,PsA and AS.Anti-TNF-αtherapy,IL-1 blockade,IL-6 antagonist,Janus kinase inhibitor and phosphodiesterase type 4 blocker can reduce IR and improve diabetic hyper-glycemia in autoimmune-mediated arthritis.
基金This work was supported(in part)by a grant from Kudo Academic Foundation(Support for the academic researcher,2017).
文摘Background:Ultrasound-targeted microbubble destruction(UTMD)induces cellular inflow of drugs at low intensity,while high intensity eradicates tumor vessels.Since vascular endothelial growth factor receptor 2(VEGFR2)is highly expressed in pancreatic ductal adenocarcinoma(PDAC),VEGFR2-targeted microbubble(MB)might additionally increase the tissue specificity of drugs and thus improve antitumor effects.In addition,fixing the dual pulse intensity could maximize MB properties.This study evaluated the one-off(experiment 1)and cumulative(experiment 2)treatment effect of UTMD by regulating the dual pulse output applied to PDAC using VEGFR2-targeted MB.Methods:C57BL/6 mice inoculated with Pan-02 cells were allocated to five groups:VEGFR2-targeted MB+gemcitabine(GEM),VEGFR2-targeted MB,non-targeted MB+GEM,GEM,and control groups.After injection of GEM or GEM and either VEGFR2-targeted or non-targeted MB,UTMD was applied for several minutes at low intensity followed by high intensity application.In experiment 1,mice were treated by the protocol described above and then euthanized immediately or at the tumor diameter doubling time(TDT).In experiment 2,the same protocol was repeated weekly and mice were euthanized at TDT regardless of protocol completion.Histological analysis by CD31 and VEGFR2 staining provided microvascular density(MVD)and VEGFR2 expression along vessels(VEGFR2v)or intra/peripheral cells(VEGFR2c).Results:In experiment 1,TDT was significantly longer in the VEGFR2-targeted MB+GEM group compared to the non-targeted MB+GEM,GEM,and control groups,while the VEGFR2-targeted MB group showed no statistical significance.MVD and VEGFR2v in the immediate euthanasia was significantly lower in the VEGFR2-targeted MB+GEM and VEGFR2-targeted MB groups than other conditions.In experiment 2,the VEGFR2-targeted MB+GEM group produced significantly longer TDT than the GEM or control groups,whereas the VEGFR2-targeted MB group showed no significant difference.Histology revealed significantly reduced VEGFR2v and VEGFR2c in the VEGFR2-targeted and non-targeted MB+GEM groups,while only VEGFR2v was significantly less in the VEGFR2-targeted MB group.Conclusions:UTMD-mediated GEM therapy with the dual pulse application using VEGFR2-targeted MB substantially suppresses PDCA growth.
基金Supported by Major Program in Zhejiang Science and Technology Department(2008C22G2100038)Emerging Artists Project in Zhejiang Province(21000037)~~
文摘[ Objective] The study aimed to supply important basis for developing environment-friendly pesticides with myricetin and crude extract of Myrica rubra leaves as effective components. [ Method] According to ＂Test guidelines for environmental safety evaluation on chemical pesticides＂, the toxicity of myricetin and crude extract of M. rubra leaves on non-target organisms was determined and the safety evaluation was carried out. [Result] MyriceUn and crude extract of M. rubra leaves had low toxicity on non-target organisms, such as earthworm, silkworm and soil microbes. Myricetin showed low toxicity and the crude extract of M. rubra leaves showed middle toxicity on tadpole. The high-concentration crude extract of M. rubra leaves had some antifeedant effect on silkworm. [ Conclusion] Myricetin and crude extract of M. rubra leaves had low toxicity on non-tar- get organisms in environment and they were relatively safe.
文摘Leukemia relapse is still the leading cause of treatment failure after allogeneic hematopoietic stem cell transplantation (allo-HSCT) for B cell acute lymphoblastic leukemia (B-ALL). Relapsed patients with BALL after allo-HSCT have a very short median survival. Minimal residual disease (MRD) is predictive of forthcoming hematological relapse after hematopoietic stem cell transplantation (HSCT);furthermore, eliminating MRD effectively prevents relapse. Donor lymphoblastic infusion (DLI) is the main established approach to treat B-ALL with MRD after allo-HSCT. However, about one-third of patients with MRD are non-responsive to DLI and their prognosis worsens. Although donor-derived cluster of differentiation (CD)19-directed chimeric antigen receptor-modified (CAR) T cells (CART19s) can potentially cure leukemia, the efficiency and safety of infusions with these cells have not yet been investigated in patients with MRD after HSCT. Between September 2014 and February 2018, six patients each received one or more infusions of CART19s from HSCT donors. Five (83.33%) achieved MRD-negative remission, and one case was not responsive to the administration of CAR T cells. Three of the six patients are currently alive without leukemia. No patient developed acute graft-versus-host disease (aGVHD), and no patient died of cytokine release syndrome. Donor-derived CAR T cell infusions seem to be an effective and safe intervention for patients with MRD in B-ALL after allo-HSCT and for those who were not responsive to DLI.
基金This project was supported by the National Defense Pre-Research Foundation of China
文摘The basic concepts and models of weapon-target assignment （WTA） are introduced and the mathematical nature of the WTA models is also analyzed. A systematic survey of research on WTA problem is provided. The present research on WTA is focused on models and algorithms. In the research on models of WTA, the static WTA models are mainly studied and the dynamic WTA models are not fully studied in deed. In the research on algorithms of WTA, the intelligent algorithms are often used to solve the WTA problem. The small scale of static WTA problems has been solved very well, however, the large scale of dynamic WTA problems has not been solved effectively so far. Finally, the characteristics of dynamic WTA are analyzed and directions for the future research on dynamic WTA are discussed.
基金the 973 Program (2001CB109004and 2007CB109202)the Key Projects for Breeding Genetically Modified Organisms of China (2011ZX0811-002 and 2009ZX08011-008B)
文摘Transgenic insect-resistant cotton is being increasingly planted in Xinjiang cotton-planting regions, where geographical climate conditions and species composition of pests and natural enemies are greatly unique in China. Limited studies have been conducted on the ecological impacts of transgenic insect-resistant cotton, especially for transgenic double genes （Bt＋CpTI） cotton, in this region. In this study, the potential effects of transgenic Bt＋CpTI cotton on the seasonal abundance of non-target pests and predators were assessed from 2009 to 2011 in Korla, Xinjiang. The results showed that species composition and seasonal abundance of 5 groups of pests and 5 groups of predators were not significantly different between transgenic Bt＋CpTI cotton and non-transgenic cotton every year. It suggests that transgenic Bt＋CpTI cotton per se does not affect the population dynamics of non-target pests and predators on this crop in Xinjiang.
基金Supported by A grant from the National Nature Science Foundation of China,No. 30672073
文摘"Vasculogenic mimicry(VM)",is a term that describes the unique ability of highly aggressive tumor cells to express a multipotent,stem cell-like phenotype,and form a pattern of vasculogenic-like networks in threedimensional culture.As an angiogenesis-independent pathway,VM and/or periodic acid-schiff-positive patterns are associated with poor prognosis in tumor patients.Moreover,VM is resistant to angiogenesis inhibitors.Here,we will review the advances in research on biochemical and molecular signaling pathways of VM in tumors and on potential anti-VM therapy strategy.
基金supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001)the National Natural Science Foundation of China (81471001)the Inner Mongolia Science and Technology Program, China (201502073)
文摘The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
基金National Natural Science Foundation of China(81603385)China Postdoctoral Science Foundation(2018M643843)+1 种基金Natural Science Foundation of Shaanxi Province(2017JM8056)Key Research and Development Foundation of Shaanxi province(2018SF-241)
文摘OBJECTIVE Numerous references made clear that triphala is revered as a multiuse therapeutic and perhaps even panacea historically.Nevertheless,the protective mechanism of triphala on cardio-cerebral vascular diseases(CCVDs)remains not comprehensive understanding.Hence,a network pharmacology-based method was suggested in this study to address this problem.METHODS This study was based on network pharmacology and bioinformatics analysis.Information on compounds in herbal medicines of triphala formula was acquired from public databases.Oral bioavailability as well as drug-likeness were screened by using absorption,distribution,metabolism,and excretion(ADME)criteria.Then,components of triphala,candidate targets of each component and known therapeutic targets of CCVDs were collected.Compound-target gene and compounds-CCVDs target networks were created through network pharmacology data sources.In addition,key targets and pathway enrichment were analyzed by STRING database and DAVID database.Moreover,we verified three of the key targets(PTGS2,MMP9 and IL-6)predicted by using Western blotting analysis.RESULTS Network analysis determined 132 compounds in three herbal medicines that were subjected to ADME screening,and 23 compounds as well as 65 genes formed the principal pathways linked to CCVDs.And 10 compounds,which actually linked to more than three genes,are determined as crucial chemicals.Core genes in this network were IL-6,TNF,VEGFA,PTGS2,CXCL8,TP53,CCL2,IL-10,MMP9 and SERPINE1.And pathways in cancer,TNF signaling path⁃way,neuroactive ligand-receptor interaction,etc.related to CCVDs were identified.In vitro experiments,the results indi⁃cated that compared with the control group(no treatment),PTGS2,MMP9 and IL-6 were up-regulated by treatment of 10μg·L^-1 TNF-α,while pretreatment with 20-80 mg·L^-1 triphala could significantly inhibit the expression of PTGS2,MMP9 and IL-6.With increasing Triphala concentration,the expression of PTGS2,MMP9 and IL-6 decreased.CON⁃CLUSION Complex components and pharmacological mechanism of triphala,and obtained some potential therapeutic targets of CCVDs,which could provide theoretical basis for the research and development of new drugs for treating CCVDs.
文摘A novel data association algorithm is developed based on fuzzy geneticalgorithms (FGAs). The static part of data association uses one FGA to determine both the lists ofcomposite measurements and the solutions of m-best S-D assignment. In the dynamic part of dataassociation, the results of the m-best S-D assignment are then used in turn, with a Kalman filterstate estimator, in a multi-population FGA-based dynamic 2D assignment algorithm to estimate thestates of the moving targets over time. Such an assignment-based data association algorithm isdemonstrated on a simulated passive sensor track formation and maintenance problem. The simulationresults show its feasibility in multi-sensor multi-target tracking. Moreover, algorithm developmentand real-time problems are briefly discussed.
基金jointly granted by the Science and Technology on Avionics Integration Laboratory and the Aeronautical Science Foundation of China (No. 2016ZC15008)
文摘A decision-making problem of missile-target assignment with a novel particle swarm optimization algorithm is proposed when it comes to a multiple target collaborative combat situation.The threat function is established to describe air combat situation.Optimization function is used to find an optimal missile-target assignment.An improved particle swarm optimization algorithm is utilized to figure out the optimization function with less parameters,which is based on the adaptive random learning approach.According to the coordinated attack tactics,there are some adjustments to the assignment.Simulation example results show that it is an effective algorithm to handle with the decision-making problem of the missile-target assignment(MTA)in air combat.
文摘In this study, we examined the effects of neuroglobin gene （Ngb） transfection into SH-SY5Y cells, using ultrasound-targeted microbubble destruction （UTMD）, on cobalt chloride-induced hypoxia. With an ultrasound intensity of 0.8 W/cm2, a 60-second exposure duration, 50% duty cycle, and 20% microbubble concentration, pAcGFP1-C1-Ngb-transfected cells exhibited the highest cell viability and transfection efficiency. The efficiency of plasmid delivery was significantly higher with UTMD than transfection with plasmid alone, transfection with plasmid using microbubbles, or transfection of plasmid by ultrasound. In addition, during cobalt chloride-induced hypoxia, caspase-3 activity in pAcGFP1-C1-Ngb-transfected cells was significantly lower than in untransfected cells. Ngb protein and mRNA expression were significantly higher in cells transfected by UTMD than in cells transfected with the other methods. These results demonstrate that UTMD can very efficiently mediate exogenous gene delivery, and that Ngb overexpression protects cells against cobalt chloride-induced hypoxia.
基金financed by the National Natural Science Foundation of China(31371952)the Special Fund for Agro-scientific Research in the Public Interest of China(201303031)
文摘American sloughgrass(Beckmannia syzigachne(Steud.) Fernald) is one of the most competitive and malignant weeds in rice-wheat rotation fields in China. American sloughgrass populations in the Jiangsu Province of China became less sensitive to acetohydroxyacid synthase(AHAS) inhibitors after repeated application for many years in these areas. Two suspected resistant American sloughgrass populations(R1 and R2) collected in the field were detected the resistance to inhibitors of AHAS in whole-plant dose-response assays, compared to the susceptible(S) population. These assays indicated that R1 showed low resistance to mesosulfuron-methyl(3.32-fold), imazapic(2.84-fold) and pyroxsulam(1.55-fold), moderate resistance to flazasulfuron(4.67-fold) and pyribenzoxim(7.41-fold), and high resistance to flucarbazone(11.73-fold). However, using a combination of the cytochrome P450 inhibitor, malathion, with mesosulfuron-methyl resulted in a reduction in R1 resistance relative to mesosulfuron-methyl alone. Furthermore, R2 was highly resistant to flazasulfuron(34.90-fold), imazapic(11.30-fold), flucarbazone(49.20-fold), pyribenzoxim(12.94-fold), moderately resistant to mesosulfuron-methyl(9.77-fold) and pyroxsulam(6.26-fold), and malathion had no effect on R2 resistance to mesosulfuron-methyl. The fulllength of AHAS genes was sequenced and the AHAS enzymes were assayed in vitro in order to clarify the mechanism of resistance to AHAS inhibitors in R1 and R2 populations. The results demonstrated that R2 had a Pro-197-Ser mutation in the AHAS gene, and the sensitivity of R2 to the five AHAS inhibitors was decreased, which may result in R2 resistance to AHAS inhibitors. There was no mutation in the AHAS gene of R1, and there were no significant differences in enzyme sensitivity between susceptible(S) and resistant(R1) populations. An enhanced metabolism may be the main mechanism of R1 resistance to AHAS inhibitors.
基金This paper was supported by the Natural Science Foundation of Jiangsu Province, China (No. BK2004132).
文摘Much research mainly focuses on the batch processing method （e.g. maximum likelihood method） when bearings-only multiple targets tracking of bistatic sonar system is considered. In this paper, the idea of recursive processing method is presented and employed, and corresponding data association algorithms, i.e. a multi-objective ant-colony-based optimization algorithm and an easy fast assignment algorithm are developed to solve the measurements-to-measurements and measurements-to-tracks data association problems of bistatic sonar system, respectively. Monte-Carlo simulations are induced to evaluate the effectiveness of the proposed methods.
基金Supported by the National Natural Science Foundation of China Youth Science Fund Project(Nos.62101405,61372185)
文摘This paper proposed a robust method based on the definition of Mahalanobis distance to track ground moving target. The feature and the geometry of airborne ground moving target tracking systems are studied at first. Based on this feature, the assignment relation of time-nearby target is calculated via Mahalanobis distance, and then the corresponding transformation formula is deduced. The simulation results show the correctness and effectiveness of the proposed method.
文摘BACKGROUND Crohn’s disease(CD)can affect the entire gastrointestinal tract.Proximal small bowel(SB)lesions are associated with a significant risk of stricturing disease and multiple abdominal surgeries.The assessment of SB in patients with CD is therefore necessary because it may have a significant impact on prognosis with potential therapeutic implications.Because of the weak correlation that exists between symptoms and endoscopic disease activity,the“treat-to-target”paradigm has been developed,and the associated treatment goal is to achieve and maintain deep remission,encompassing both clinical and endoscopic remission.Small bowel capsule endoscopy(SBCE)allows to visualize the mucosal surface of the entire SB.At that time,there is no recommendation regarding the use of SBCE during follow-up.AIM To investigate the impact of SBCE in a treat-to-target strategy in patients with CD.METHODS An electronic literature search was conducted in PubMed and Cochrane library using the following search terms:“capsule endoscopy”,in combination with“Crohn’s disease”and“treat-to-target”or synonyms.Two authors independently reviewed titles and abstracts identified by the search strategy after duplicates were removed.Following the initial screening of abstracts,all articles containing information about SBCE in the context of treat-to-target strategy in patients with CD were included.Full-text articles were retrieved,reference lists were screened manually to identify additional studies.RESULTS Forty-seven articles were included in this review.Two indexes are currently used to quantify disease activity using SBCE,and there is good correlation between them.SBCE was shown to be useful for disease reclassification in patients who are suspected of having or who are diagnosed with CD,with a significant incremental diagnostic yield compared to other diagnostic modalities.Nine studies also demonstrated that the mucosal healing can be evaluated by SBCE to monitor the effect of medical treatment in patients with CD.This review also demonstrated that SBCE can detect post-operative recurrence to a similar extent as ileocolonoscopy,and proximal SB lesions that are beyond the reach of the colonoscope in over half of the patients.CONCLUSION SBCE could be incorporated in the treat-to-target algorithm for patients with CD.Randomized controlled trials are required to confirm its usefulness and reliability in this indication.
