The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work...The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.展开更多
The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the prese...The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.展开更多
Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chro...Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.展开更多
In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondri...In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.展开更多
In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal a...In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian＇s empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young＇s modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young＇s modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.展开更多
Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric ...Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system： intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.展开更多
A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was charact...A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620（6）, b = 10.4590（15）, c = 10.5052（15） A, a = 69.310（2）, β = 83.608（2）, γ = 78.873（2）°, V = 419.30（10） A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F（000） = 304 and/^（MoKa） = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ（I） and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.展开更多
Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.展开更多
DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rear...DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rearrangements,which predisposes an organism to immunodeficiency,neurological damage,and cancer.The tumor repressor p53 plays a key role in DNA damage response,and has been found to be mutated in 50%of human cancer.p53,p63,and p73 are three members of the p53 gene family.Recent discoveries have shown that human p53 gene encodes at least 12 isoforms.Different p53 members and isoforms play various roles in orchestrating DNA damage response to maintain genomic integrity.This review briefly explores the functions of p53 and its isoforms in DNA DSB repair.展开更多
We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to ...We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to the formation of linear supramolecular polymers.展开更多
The interaction of double-stranded （ds） and G-quadruplex （G4） DNA with sulfonyl 5-fluorouracil derivatives （5-fluoro-l-（arylsulfonyl） pyrimidine-2,4 （1H,3H）-diones） was investigated in this research, in whic...The interaction of double-stranded （ds） and G-quadruplex （G4） DNA with sulfonyl 5-fluorouracil derivatives （5-fluoro-l-（arylsulfonyl） pyrimidine-2,4 （1H,3H）-diones） was investigated in this research, in which Au electrodes modified with ds-DNA or G4-DNAs were used as a working electrode. The investigation showed that the binding affinity with G4-DNA was significantly increased when 5-fluorouracil （5-FU） was modified with arylsulfonyl groups. The presence of strong electron-withdrawing groups on benzene sulfonyl 5-FU greatly enhanced the binding selectivity （kG4-DNA/kds-DNA）. Such results provided new insights into the potential connections between the chemical structure of drug candidates and their anticancer activities.展开更多
The site-specific mutagenesis of the gene has become an important technique in gene modification and protein engineering. Among all methods, the primer extension one using single-stranded DNA (such as the infective fo...The site-specific mutagenesis of the gene has become an important technique in gene modification and protein engineering. Among all methods, the primer extension one using single-stranded DNA (such as the infective form of the M13 phage ) as template and the gapped stranded one are commonly used. But some genes, especially those展开更多
Plant-mediated RNA interference(RNAi)has emerged as a promising technology for insect control.The green peach aphid,Myzus persicae,feeds on over 400 species of host plants.Brassica napus(rape)is the second most import...Plant-mediated RNA interference(RNAi)has emerged as a promising technology for insect control.The green peach aphid,Myzus persicae,feeds on over 400 species of host plants.Brassica napus(rape)is the second most important oilseed crop worldwide.Myzus persicae is highly reproductive and causes severe damage to the rape plants due to its quite flexible life cycle.In this study,we tested the RNAi effects of transgenic rape plants on M.persicae.By in vitro feeding M.persicae with artificial diets containing double-stranded RNAs(dsRNAs)targeting seven aphid genes,we identified a new gene encoding the partitioning-defective protein 6(Par6)as the most potent RNAi target.Tissue-and stage-expression analysis of Par6 suggested this gene is highly expressed in the embryo and adult stage of M.persicae.We next generated transgenic rape plants expressing ds Par6 by Agrobacteriummediated transformation and obtained nine independent transgenic lines.Compared to wild-type control plants,transgenic rape lines expressing ds Par6 showed strong resistance to M.persicae.Feeding assays revealed that feeding transgenic rape plants to M.persicae significantly decreased MpPar6 expression and survival rate and impaired fecundity.Furthermore,we showed that the resistance levels to M.persicae are positively correlated with ds Par6 expression levels in transgenic rape plants.Our study demonstrates that transgenic rape plants expressing ds Par6 are efficiently protected from M.persicae.Interfering with the genes involved in embryo development could be the effective RNAi targets for controlling aphids and potentially other insect pests.展开更多
BACKGROUND Poly(ADP-ribose)polymerase inhibitors(PARPis)are approved as first-line therapies for breast cancer gene(BRCA)-positive,human epidermal growth factor receptor 2-negative locally advanced or metastatic breas...BACKGROUND Poly(ADP-ribose)polymerase inhibitors(PARPis)are approved as first-line therapies for breast cancer gene(BRCA)-positive,human epidermal growth factor receptor 2-negative locally advanced or metastatic breast cancer.They are also effective for new and recurrent ovarian cancers that are BRCA-or homologous recombination deficiency(HRD)-positive.However,data on these mutations and PARPi use in the Middle East are limited.AIM To assess BRCA/HRD prevalence and PARPi use in patients in the Middle East with breast/ovarian cancer.METHODS This was a single-center retrospective study of 57 of 472 breast cancer patients tested for BRCA mutations,and 25 of 65 ovarian cancer patients tested for HRD.These adult patients participated in at least four visits to the oncology service at our center between August 2021 and May 2023.Data were summarized using descriptive statistics and compared using counts and percentages.Response to treatment was assessed using Response Evaluation Criteria in Solid Tumors criteria.RESULTS Among the 472 breast cancer patients,12.1%underwent BRCA testing,and 38.5%of 65 ovarian cancer patients received HRD testing.Pathogenic mutations were found in 25.6%of the tested patients:26.3%breast cancers had germline BRCA(gBRCA)mutations and 24.0%ovarian cancers showed HRD.Notably,40.0%of gBRCA-positive breast cancers and 66.0%of HRD-positive ovarian cancers were Middle Eastern and Asian patients,respectively.PARPi treatment was used in 5(33.3%)gBRCA-positive breast cancer patients as first-line therapy(n=1;7-months progression-free),for maintenance(n=2;>15-months progression-free),or at later stages due to compliance issues(n=2).Four patients(66.6%)with HRD-positive ovarian cancer received PARPi and all remained progression-free.CONCLUSION Lower testing rates but higher BRCA mutations in breast cancer were found.Ethnicity reflected United Arab Emirates demographics,with breast cancer in Middle Eastern and ovarian cancer in Asian patients.展开更多
The purpose of the study was to investigate if the high gradient strength and slew rate used for long MRI-thermometry monitoring could cause DNA double-stranded breaks (DSBs). To this end, an enzyme-linked immunosorbe...The purpose of the study was to investigate if the high gradient strength and slew rate used for long MRI-thermometry monitoring could cause DNA double-stranded breaks (DSBs). To this end, an enzyme-linked immunosorbent assay (ELISA) was used to quantify γH2AX, a molecular marker for DSBs, in the blood of mice after a 6-hour exposure to magnetic resonance imaging (MRI). Fourteen CF-1 female mice were separated into 4 experimental groups: Untreated negative control, MRI-treated, MRI-Control, and exposed to ionizing radiation positive control. Untreated negative control was used as a baseline for ELISA to quantify γH2AX. MRI-treated consisted of a 6-hour continuous magnetic resonance imaging (MRI) echo planar imaging (EPI) sequence with a slew rate of 192 mT/m/s constituting a significantly longer imaging time than routine clinical imaging. MRI-control mice were maintained under the same conditions outside the MRI scanner for 6-hours. Mice in the irradiation group served as a positive control of DSBs and were exposed to either 2 Gy, 5 Gy or 10 Gy of ionizing radiation. DSBs in the blood lymphocytes from the treatment groups were analyzed using the γH2AX ELISA and compared. Total protein concentration in lysates was determined for each blood sample and averaged 1 ± 0.35 mg/mL. Irradiated positive controls were used to test radiation dose-dependency of the γH2AX ELISA assay where a linear dependency on radiation exposure was observed (r<sup>2</sup> = 0.93) between untreated and irradiated samples. Mean and standard error mean of γH2AX formation were calculated and compared between each treatment group. Repeated measures 1-way ANOVA showed statistically significant differences between the means of irradiated controls and both the MRI-control and MRI-treated groups. There was no statistically significant difference between the MRI-treated samples and the MRI-control groups. Our results show that long MRI exposure at a high slew rate did not cause increased levels of γH2AX when compared to control mice, suggesting that no increase in DSBs was caused by the long MR thermometry imaging session. The novelty of this work contradicts other studies that have suggested MRI may cause DSBs;this work suggests an alternative cause of DNA damage.展开更多
Hepatitis B virus(HBV)-induced hepatocellular carcinoma(HCC) is one of the most fre-quently occurring cancers.Hepadnaviral DNA integrations are considered to be essential agents which can promote the process of the he...Hepatitis B virus(HBV)-induced hepatocellular carcinoma(HCC) is one of the most fre-quently occurring cancers.Hepadnaviral DNA integrations are considered to be essential agents which can promote the process of the hepatocarcinogenesis.More and more researches were designed to find the relationship of the two.In this study,we investigated whether HBV DNA integration occurred at sites of DNA double-strand breaks(DSBs),one of the most detrimental DNA damage.An 18-bp I-SceI homing endonuclease recognition site was introduced into the DNA of HepG2 cell line by stable DNA transfection,then cells were incubated in patients’ serum with high HBV DNA copies and at the same time,DSBs were induced by transient expression of I-SceI after transfection of an I-SceI expression vector.By using nest PCR,the viral DNA was detected at the sites of the break.It appeared that integra-tion occurred between part of HBV x gene and the I-SceI induced breaks.The results suggested that DSBs,as the DNA damages,may serve as potential targets for hepadnaviral DNA insertion and the integrants would lead to widespread host genome changes necessarily.It provided a new site to investi-gate the integration.展开更多
DNA damage in oocytes can cause infertility and birth defects. DNA double-strand breaks （DSBs） are highly deleterious and can substantially impair genome integrity. Homologous recombination （HR）-mediated DNA DSB r...DNA damage in oocytes can cause infertility and birth defects. DNA double-strand breaks （DSBs） are highly deleterious and can substantially impair genome integrity. Homologous recombination （HR）-mediated DNA DSB repair plays dominant roles in safeguarding oocyte quantity and quality. However, little is known regarding the key players of the HR repair pathway in oocytes. Here, we identified oocyte-specific gene Ooep as a novel key component of the HR repair pathway in mouse oocytes. OOEP was required for efficient ataxia telangiectasia mutated （ATM） kinase activation and Rad51 recombinase （RAD51） focal accumulation at DNA DSBs. Ooep null oocytes were defective in DNA DSB repair and prone to apoptosis upon exogenous DNA damage insults. Moreover, Ooep null oocytes exhibited delayed meiotic maturation. Therefore, OOEP played roles in preserving oocyte quantity and quality by maintaining genome stability. Ooep expression decreased with the advance of maternal age, suggesting its involvement in maternal aging.展开更多
Gene targeting technology is an important means to investigate gene functions, but its efficiency of gene targeting is very low, especially for somatic cell targeting. Artificially induced double-strand breaks （DSB）...Gene targeting technology is an important means to investigate gene functions, but its efficiency of gene targeting is very low, especially for somatic cell targeting. Artificially induced double-strand breaks （DSB） and triplex forming oligonucleotide （TFO） are currently developed methods to improve the targeting efficiency. This paper summarized the basic principles, design ideas and application in gene targeting efficiency improvement of these two methods, analyzed and com- pared their characteristics, and finally proposed prospects for their future development.展开更多
Double-stranded RNA-mediated interference (RNAi), antisense oligonucleotides (ASO), and ribozymes have excellent specificity to their target oncogenic mRNA. They also seem to show great promise when it comes to treati...Double-stranded RNA-mediated interference (RNAi), antisense oligonucleotides (ASO), and ribozymes have excellent specificity to their target oncogenic mRNA. They also seem to show great promise when it comes to treating cancer. The problem is that RNAi, ASO, and ribozymes have poor stability and are constantly being degraded by nucleases. Researchers have made some efforts to increase antisense oligonucleotides’ stability by creating phospharimidate and Phosphorothioate. Currently, ribozymes, antisense oligonucleotides, and (RNAi) are the three main methods used to target RNA. These methods are currently undergoing clinical trials for the purpose of focusing on specific RNAs involved in disorders like cancer and neurodegeneration. In fact, ASOs that target amyotrophic lateral sclerosis and spinal muscular atrophy have produced promising results in clinical trials. The formation of chemical alterations that boost affinity and selectivity while reducing noxiousness owing to off-target impacts are two benefits of ASOs. Another benefit is increased affinity. With a focus on RNAi and ASOs, this review illustrated the main therapeutic strategies of RNA therapy now in use.展开更多
Accumulating evidence indicates that ataxia-telangiectasia mutated kinase is critical for maintaining cellular homeostasis and that it has both nuclear and cytoplasmic functions.However,the functions of ataxia-telangi...Accumulating evidence indicates that ataxia-telangiectasia mutated kinase is critical for maintaining cellular homeostasis and that it has both nuclear and cytoplasmic functions.However,the functions of ataxia-telangiectasia mutated that when lost lead to cerebellar degeneration are still unknown.In this review,we first describe the role of ataxia-telangiectasia mutated in cerebellar pathology.In addition to its canonical nuclear functions in DNA damage response circuits,ataxia-telangiectasia mutated functions in various cytoplasmic and mitochondrial processes that are critically important for cellular homeostasis.We discuss these functions with a focus on the role of ataxia-telangiectasia mutated in maintaining the homeostatic redox state.Finally,we describe the unique functions of ataxia-telangiectasia mutated in various types of neuronal and glial cells including cerebellar granule neurons,astrocytes,and microglial cells.展开更多
基金Project supported by the National Natural Science Foundation of China (Grant No.11974366)the Fundamental Research Funds for the Central Universities+2 种基金Chinathe Supercomputer Center of the Chinese Academy of Sciencesthe Shanghai Supercomputer Center of China。
文摘The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.
文摘The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.
基金The authors thank Alexandra Surcel and Carey L Hendrix Lord for helpful comments on this manuscript.The work in our laboratory is supported by grants from the National Science Foundation(IBN-0077832,MCB-9896340,MCB-0092075)the National Institutes of Health(R0 1 GM63871)+3 种基金the US Department of Agriculture(2001-35301-10570 and 2003-35301-13313)Wuxing L was partially supported by the Intercollege Graduate Degree Program in Plant PhysiologyHong M gratefully acknowledges the support of the John Simon Guggenheim Foundationthe National Institutes of Health(F33 GM72245-1).
文摘Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.
文摘In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.
基金supported by the National Natural Science Foundation of China(11272193 and 10872121)the Shanghai Leading Academic Discipline Project(S30106)
文摘In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian＇s empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young＇s modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young＇s modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.
基金supported in part by the National Natural Science Foundation of China (Grant No. 11004082)the Natural Science Foundation of Guangdong Province of China (Grant No. 01005249)the Fundamental Research Funds for the Central Universities of China (Grant No. 21609305)
文摘Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system： intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.
基金Supported by the National Natural Science Foundation of China (61205184)the Department of Education of Zhejiang Province (Y201122207)+1 种基金Open Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (YR2012013)the Young Researchers Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (ZYG2012003)
文摘A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620（6）, b = 10.4590（15）, c = 10.5052（15） A, a = 69.310（2）, β = 83.608（2）, γ = 78.873（2）°, V = 419.30（10） A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F（000） = 304 and/^（MoKa） = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ（I） and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.
基金supported by the National Natural Science Foundation of China(Nos.31571511 and 31871500)
文摘DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rearrangements,which predisposes an organism to immunodeficiency,neurological damage,and cancer.The tumor repressor p53 plays a key role in DNA damage response,and has been found to be mutated in 50%of human cancer.p53,p63,and p73 are three members of the p53 gene family.Recent discoveries have shown that human p53 gene encodes at least 12 isoforms.Different p53 members and isoforms play various roles in orchestrating DNA damage response to maintain genomic integrity.This review briefly explores the functions of p53 and its isoforms in DNA DSB repair.
基金financially supported by the National Natural Science Foundation of China(Nos.21574054,21722403,and 21420102007)
文摘We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to the formation of linear supramolecular polymers.
基金supported by the National Natural Science Foundation of China (21073133,20843007)Zhejiang Provincial Natural Science Foundation of China (Y4080177,Y4090248,Y5100283)Zhejiang Provincial Ministry of Education (Y200907715)
文摘The interaction of double-stranded （ds） and G-quadruplex （G4） DNA with sulfonyl 5-fluorouracil derivatives （5-fluoro-l-（arylsulfonyl） pyrimidine-2,4 （1H,3H）-diones） was investigated in this research, in which Au electrodes modified with ds-DNA or G4-DNAs were used as a working electrode. The investigation showed that the binding affinity with G4-DNA was significantly increased when 5-fluorouracil （5-FU） was modified with arylsulfonyl groups. The presence of strong electron-withdrawing groups on benzene sulfonyl 5-FU greatly enhanced the binding selectivity （kG4-DNA/kds-DNA）. Such results provided new insights into the potential connections between the chemical structure of drug candidates and their anticancer activities.
基金Project supported by the National High Technology Foundation (Term No. 103-20).
文摘The site-specific mutagenesis of the gene has become an important technique in gene modification and protein engineering. Among all methods, the primer extension one using single-stranded DNA (such as the infective form of the M13 phage ) as template and the gapped stranded one are commonly used. But some genes, especially those
基金supported by the National Natural Science Foundation of China(32102297 and 32272634)。
文摘Plant-mediated RNA interference(RNAi)has emerged as a promising technology for insect control.The green peach aphid,Myzus persicae,feeds on over 400 species of host plants.Brassica napus(rape)is the second most important oilseed crop worldwide.Myzus persicae is highly reproductive and causes severe damage to the rape plants due to its quite flexible life cycle.In this study,we tested the RNAi effects of transgenic rape plants on M.persicae.By in vitro feeding M.persicae with artificial diets containing double-stranded RNAs(dsRNAs)targeting seven aphid genes,we identified a new gene encoding the partitioning-defective protein 6(Par6)as the most potent RNAi target.Tissue-and stage-expression analysis of Par6 suggested this gene is highly expressed in the embryo and adult stage of M.persicae.We next generated transgenic rape plants expressing ds Par6 by Agrobacteriummediated transformation and obtained nine independent transgenic lines.Compared to wild-type control plants,transgenic rape lines expressing ds Par6 showed strong resistance to M.persicae.Feeding assays revealed that feeding transgenic rape plants to M.persicae significantly decreased MpPar6 expression and survival rate and impaired fecundity.Furthermore,we showed that the resistance levels to M.persicae are positively correlated with ds Par6 expression levels in transgenic rape plants.Our study demonstrates that transgenic rape plants expressing ds Par6 are efficiently protected from M.persicae.Interfering with the genes involved in embryo development could be the effective RNAi targets for controlling aphids and potentially other insect pests.
文摘BACKGROUND Poly(ADP-ribose)polymerase inhibitors(PARPis)are approved as first-line therapies for breast cancer gene(BRCA)-positive,human epidermal growth factor receptor 2-negative locally advanced or metastatic breast cancer.They are also effective for new and recurrent ovarian cancers that are BRCA-or homologous recombination deficiency(HRD)-positive.However,data on these mutations and PARPi use in the Middle East are limited.AIM To assess BRCA/HRD prevalence and PARPi use in patients in the Middle East with breast/ovarian cancer.METHODS This was a single-center retrospective study of 57 of 472 breast cancer patients tested for BRCA mutations,and 25 of 65 ovarian cancer patients tested for HRD.These adult patients participated in at least four visits to the oncology service at our center between August 2021 and May 2023.Data were summarized using descriptive statistics and compared using counts and percentages.Response to treatment was assessed using Response Evaluation Criteria in Solid Tumors criteria.RESULTS Among the 472 breast cancer patients,12.1%underwent BRCA testing,and 38.5%of 65 ovarian cancer patients received HRD testing.Pathogenic mutations were found in 25.6%of the tested patients:26.3%breast cancers had germline BRCA(gBRCA)mutations and 24.0%ovarian cancers showed HRD.Notably,40.0%of gBRCA-positive breast cancers and 66.0%of HRD-positive ovarian cancers were Middle Eastern and Asian patients,respectively.PARPi treatment was used in 5(33.3%)gBRCA-positive breast cancer patients as first-line therapy(n=1;7-months progression-free),for maintenance(n=2;>15-months progression-free),or at later stages due to compliance issues(n=2).Four patients(66.6%)with HRD-positive ovarian cancer received PARPi and all remained progression-free.CONCLUSION Lower testing rates but higher BRCA mutations in breast cancer were found.Ethnicity reflected United Arab Emirates demographics,with breast cancer in Middle Eastern and ovarian cancer in Asian patients.
文摘The purpose of the study was to investigate if the high gradient strength and slew rate used for long MRI-thermometry monitoring could cause DNA double-stranded breaks (DSBs). To this end, an enzyme-linked immunosorbent assay (ELISA) was used to quantify γH2AX, a molecular marker for DSBs, in the blood of mice after a 6-hour exposure to magnetic resonance imaging (MRI). Fourteen CF-1 female mice were separated into 4 experimental groups: Untreated negative control, MRI-treated, MRI-Control, and exposed to ionizing radiation positive control. Untreated negative control was used as a baseline for ELISA to quantify γH2AX. MRI-treated consisted of a 6-hour continuous magnetic resonance imaging (MRI) echo planar imaging (EPI) sequence with a slew rate of 192 mT/m/s constituting a significantly longer imaging time than routine clinical imaging. MRI-control mice were maintained under the same conditions outside the MRI scanner for 6-hours. Mice in the irradiation group served as a positive control of DSBs and were exposed to either 2 Gy, 5 Gy or 10 Gy of ionizing radiation. DSBs in the blood lymphocytes from the treatment groups were analyzed using the γH2AX ELISA and compared. Total protein concentration in lysates was determined for each blood sample and averaged 1 ± 0.35 mg/mL. Irradiated positive controls were used to test radiation dose-dependency of the γH2AX ELISA assay where a linear dependency on radiation exposure was observed (r<sup>2</sup> = 0.93) between untreated and irradiated samples. Mean and standard error mean of γH2AX formation were calculated and compared between each treatment group. Repeated measures 1-way ANOVA showed statistically significant differences between the means of irradiated controls and both the MRI-control and MRI-treated groups. There was no statistically significant difference between the MRI-treated samples and the MRI-control groups. Our results show that long MRI exposure at a high slew rate did not cause increased levels of γH2AX when compared to control mice, suggesting that no increase in DSBs was caused by the long MR thermometry imaging session. The novelty of this work contradicts other studies that have suggested MRI may cause DSBs;this work suggests an alternative cause of DNA damage.
基金supported by grants from National Natural Sciences Foundation of China (No.30872237)the National Basic Research Program of China(No.2007CB512900)
文摘Hepatitis B virus(HBV)-induced hepatocellular carcinoma(HCC) is one of the most fre-quently occurring cancers.Hepadnaviral DNA integrations are considered to be essential agents which can promote the process of the hepatocarcinogenesis.More and more researches were designed to find the relationship of the two.In this study,we investigated whether HBV DNA integration occurred at sites of DNA double-strand breaks(DSBs),one of the most detrimental DNA damage.An 18-bp I-SceI homing endonuclease recognition site was introduced into the DNA of HepG2 cell line by stable DNA transfection,then cells were incubated in patients’ serum with high HBV DNA copies and at the same time,DSBs were induced by transient expression of I-SceI after transfection of an I-SceI expression vector.By using nest PCR,the viral DNA was detected at the sites of the break.It appeared that integra-tion occurred between part of HBV x gene and the I-SceI induced breaks.The results suggested that DSBs,as the DNA damages,may serve as potential targets for hepadnaviral DNA insertion and the integrants would lead to widespread host genome changes necessarily.It provided a new site to investi-gate the integration.
基金supported by the National Key Research and Development Program of China(2017YFC1001102)National Natural Science Foundation of China(81760507)
文摘DNA damage in oocytes can cause infertility and birth defects. DNA double-strand breaks （DSBs） are highly deleterious and can substantially impair genome integrity. Homologous recombination （HR）-mediated DNA DSB repair plays dominant roles in safeguarding oocyte quantity and quality. However, little is known regarding the key players of the HR repair pathway in oocytes. Here, we identified oocyte-specific gene Ooep as a novel key component of the HR repair pathway in mouse oocytes. OOEP was required for efficient ataxia telangiectasia mutated （ATM） kinase activation and Rad51 recombinase （RAD51） focal accumulation at DNA DSBs. Ooep null oocytes were defective in DNA DSB repair and prone to apoptosis upon exogenous DNA damage insults. Moreover, Ooep null oocytes exhibited delayed meiotic maturation. Therefore, OOEP played roles in preserving oocyte quantity and quality by maintaining genome stability. Ooep expression decreased with the advance of maternal age, suggesting its involvement in maternal aging.
基金Supported by Shandong Swine Industry Technology System and Science and Technology Planning Program for Basic Research in Qingdao City(12-1-4-14-jch)
文摘Gene targeting technology is an important means to investigate gene functions, but its efficiency of gene targeting is very low, especially for somatic cell targeting. Artificially induced double-strand breaks （DSB） and triplex forming oligonucleotide （TFO） are currently developed methods to improve the targeting efficiency. This paper summarized the basic principles, design ideas and application in gene targeting efficiency improvement of these two methods, analyzed and com- pared their characteristics, and finally proposed prospects for their future development.
文摘Double-stranded RNA-mediated interference (RNAi), antisense oligonucleotides (ASO), and ribozymes have excellent specificity to their target oncogenic mRNA. They also seem to show great promise when it comes to treating cancer. The problem is that RNAi, ASO, and ribozymes have poor stability and are constantly being degraded by nucleases. Researchers have made some efforts to increase antisense oligonucleotides’ stability by creating phospharimidate and Phosphorothioate. Currently, ribozymes, antisense oligonucleotides, and (RNAi) are the three main methods used to target RNA. These methods are currently undergoing clinical trials for the purpose of focusing on specific RNAs involved in disorders like cancer and neurodegeneration. In fact, ASOs that target amyotrophic lateral sclerosis and spinal muscular atrophy have produced promising results in clinical trials. The formation of chemical alterations that boost affinity and selectivity while reducing noxiousness owing to off-target impacts are two benefits of ASOs. Another benefit is increased affinity. With a focus on RNAi and ASOs, this review illustrated the main therapeutic strategies of RNA therapy now in use.
文摘Accumulating evidence indicates that ataxia-telangiectasia mutated kinase is critical for maintaining cellular homeostasis and that it has both nuclear and cytoplasmic functions.However,the functions of ataxia-telangiectasia mutated that when lost lead to cerebellar degeneration are still unknown.In this review,we first describe the role of ataxia-telangiectasia mutated in cerebellar pathology.In addition to its canonical nuclear functions in DNA damage response circuits,ataxia-telangiectasia mutated functions in various cytoplasmic and mitochondrial processes that are critically important for cellular homeostasis.We discuss these functions with a focus on the role of ataxia-telangiectasia mutated in maintaining the homeostatic redox state.Finally,we describe the unique functions of ataxia-telangiectasia mutated in various types of neuronal and glial cells including cerebellar granule neurons,astrocytes,and microglial cells.
