Gastric cancer(GC)is the fourth leading cause of cancer-related death.The occurrence and development of GC is a complex process involving multiple biological mechanisms.Although traditional regulation modulates molecu...Gastric cancer(GC)is the fourth leading cause of cancer-related death.The occurrence and development of GC is a complex process involving multiple biological mechanisms.Although traditional regulation modulates molecular functions related to the occurrence and development of GC,the comprehensive mechanisms remain unclear.Ultraconserved region(UCR)refers to a genome sequence that is completely conserved in the homologous regions of the human,rat and mouse genomes,with 100%identity,without any insertions or deletions,and often located in fragile sites and tumour-related genes.The transcribed UCR(T-UCR)is transcribed from the UCR and is a new type of long noncoding RNA.Recent studies have found that the expression level of T-UCRs changes during the occurrence and development of GC,revealing a new mechanism underlying GC.Therefore,this article aims to review the relevant research on T-UCRs in GC,as well as the function of T-UCRs and their regulatory role in the occurrence and development of GC,to provide new strategies for GC diagnosis and treatment.展开更多
Fungus-growing termites cultivate species of the mutualistic basidiomycete genus Termitomyces on a substrate called the fungal comb. Identification of fungal species based on morphological features is complicated, ted...Fungus-growing termites cultivate species of the mutualistic basidiomycete genus Termitomyces on a substrate called the fungal comb. Identification of fungal species based on morphological features is complicated, tedious, and prone to errors. As an alternative, nuclear ribosomal DNA sequences consisting of the internal transcribed spacers (ITS1 and ITS2) and 5.8S rDNA were used to identify Malaysian isolates of Termitomyces sp. The morphological characteristics and molecular data indicate that Malaysian Termitomyces isolated is clearly monophyletic and belongs to the Tricholomataceae family. The Malaysian isolates analyzed in this study represent the termite fungus species called T. aurantiacus.展开更多
Ricinus communis have attracted considerable attention because of its specific industrial and pharmacological activities. DNA barcodes can be used as reliable tools to facilitate the identification of medicinal plants...Ricinus communis have attracted considerable attention because of its specific industrial and pharmacological activities. DNA barcodes can be used as reliable tools to facilitate the identification of medicinal plants for the safe use, quality control and forensic investigation. In this study, the differential identification of eight accessions of R. com-munis was investigated through DNA sequence analysis of two candidate DNA barcodes. The nucleotide sequence of internal transcribed spacers (ITS2) and chloroplast maturase gene (matK) have been determined to construct the phylogenetic tree. The phylogenetic relationships of accessions based on the nrITS2 region and partial matK region showed that all accessions in this study were related to three geographical origins. Based on sequence align-ment and phylogenetic analyses we concluded that the ITS2 sequences can distinguish R. communis accessions from different geographical distributions.展开更多
To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplifi...To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.展开更多
Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as micr...Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.展开更多
In mammalian cells, transcribed enhancers(TrEns) play important roles in the initiation of gene expression and maintenance of gene expression levels in a spatiotemporal manner. One of the most challenging questions is...In mammalian cells, transcribed enhancers(TrEns) play important roles in the initiation of gene expression and maintenance of gene expression levels in a spatiotemporal manner. One of the most challenging questions is how the genomic characteristics of enhancers relate to enhancer activities. To date, only a limited number of enhancer sequence characteristics have been investigated, leaving space for exploring the enhancers' DNA code in a more systematic way. To address this problem, we developed a novel computational framework, Transcribed Enhancer Landscape Search(TELS), aimed at identifying predictive cell type/tissue-specific motif signatures of TrEns.As a case study, we used TELS to compile a comprehensive catalog of motif signatures for all known TrEns identified by the FANTOM5 consortium across 112 human primary cells and tissues.Our results confirm that combinations of different short motifs characterize in an optimized manner cell type/tissue-specific TrEns. Our study is the first to report combinations of motifs that maximize classification performance of TrEns exclusively transcribed in one cell type/tissue from TrEns exclusively transcribed in different cell types/tissues. Moreover, we also report 31 motif signatures predictive of enhancers' broad activity. TELS codes and material are publicly available at http://www.cbrc.kaust.edu.sa/TELS.展开更多
Shankhpushpi is a reputed drug from an Indian system of medicine for treating mental disorders and enhancing memory. Two herbs, namely Convolvulus prostratus Forssk. and Evolvulus alsinoides(L.) L., are commonly known...Shankhpushpi is a reputed drug from an Indian system of medicine for treating mental disorders and enhancing memory. Two herbs, namely Convolvulus prostratus Forssk. and Evolvulus alsinoides(L.) L., are commonly known as Shankhpushpi. Ambiguous vernacular identity can affect the scientific validity of the Shankpushpi-based herbal drug therapy. In the present investigation, a novel and sensitive multiplex PCR method based on polymorphism in the internal transcribed spacer(ITS) region was developed to establish the molecular identity of C. prostratus and E. alsinoides. DNA was isolated and the ITS region was amplified, sequenced and assembled. Sequences were aligned to identify variable nucleotides in order to develop plant-specific primers. Primers were validated in singleplex reactions and eventually a multiplex assay was developed. This assay was tested for sensitivity and validated by amplifying DNA isolated from the simulated blended powdered plant material. Primers developed for C. prostratus resulted into a 200 bp amplicon and 596 bp for E. alsinoides. The assay was found to be sensitive enough for amplification of low quantities of DNA. The method can detect 10% of the mixing of plants with each other in blended material. This PCR assay can be used for rapid botanical identification of Shankhpushpi plant materials and will improve evidence-based herbal drug therapy.展开更多
A large number of expressed sequences tags are available for Citrus spp., which provides an opportunity to understand genomic organization of the transcribed regions. Here, we report a detailed analysis of repetitive ...A large number of expressed sequences tags are available for Citrus spp., which provides an opportunity to understand genomic organization of the transcribed regions. Here, we report a detailed analysis of repetitive elements including tandem repeats(TRs) and transposable elements(TEs) in the transcribed region of the Citrus spp.On average, 22% of the expressed sequence tags(ESTs)contain TRs. The relative density of TR classes is highly taxon-specific. For instance, Citrus limonia has a high relative density of mononucleotide repeats, whereas dinucleotide repeats are rare. The proportions of 2–6,7–30 and 31–50 bp repeats were almost identical in all studied species except for C. limonia and C. limettioides.We found that < 1% of the citrus ESTs have a similarity with transposable elements. Transcriptional activity of transposable element families varied even within the same class of elements. A high proportion of transcriptional activity was observed for gypsy-like TEs compare to other TE classes. While TEs are relatively rare, TRs are abundant elements in ESTs of citrus. The high proportion of TRs that have a unit size longer than 6 bp raises the question about a possible functional or evolutionary role of these elements.展开更多
Objective:To distinguish the difference among the Clinacanthus nutans(Burm.f.)Lindau(C.nutans)and Clinacanthus siamensis Bremek(C.siamensis)by assessing pharmacognosy characteristics,molecular aspect and also to evalu...Objective:To distinguish the difference among the Clinacanthus nutans(Burm.f.)Lindau(C.nutans)and Clinacanthus siamensis Bremek(C.siamensis)by assessing pharmacognosy characteristics,molecular aspect and also to evaluate their anti-herpes simplex virus(HSV)type 1 and type 2 activities.Methods:Macroscopic and microscopic evaluation were performed according to WHO Geneva guideline.Stomatal number,stomatal index and palisade ratio of leaves were evaluated.Genomic DNA was extracted by modified CTAB method and ITS region was amplified using PGR and then sequenced.Dry leaves were subsequently extracted with n-hexane,dichloromethane and methanol and antiviral activity was performed using plaque reduction assay and the cytotoxicity of the extracts on Vero cells was determined by MTT assay.Results:Cross section of midrib and stem showed similar major components.Leaf measurement index of stomatal number,stomatal index and palisade ratio of C.nutans were 168.32±29.49,13.83±0.86 and 6.84±0.66,respectively,while C.siamensis were 161.60±18.04,11.93±0.81and 3.37±0.31,respectively.The PCR amplification of ITS region generated the PGR product approximately 700 bp in size.There were 34 polymorphisms within the ITS region which consisted of 11 Indels and 23 nucleotide substitutions.The IC_(50)values of C.nutans extracted with n-hexane,dichloromethane and methanol against HSV-1 were(32.05±3.63)μg/mL,(44.50±2.66)μg/mL,(64.93±7.00)μg/mL,respectively where as those of C.siamensis were(60.00±11.61)μg/mL,(55.69+4.41)μg/mL,(37.39±5.85)μg/mL,respectively.Anti HSV-2 activity of n-hexane,dichloromethane and methanol C.nutans leaves extracts were(72.62±12.60)μg/mL,(65.19±21.45)μg/mL,(65.13±2.22)μg/mL,respectively where as those of C.siamensis were(46.52±4.08)μg/mL,(49.63±2.59)μg/mL,(72.64±6.52)μg/mL,respectively.Conclusions:The combination of macroscopic,microscopic and biomolecular method are able to authenticate these closely related plants and both of them have a potency to be an anti-HSV agent.展开更多
The dinoflagellate genus K arenia is known for recurrent harmful blooms worldwide. However, species diversity of the genus is generally overlooked owing to the difficulty of identifying small unarmored dinoflagellates...The dinoflagellate genus K arenia is known for recurrent harmful blooms worldwide. However, species diversity of the genus is generally overlooked owing to the difficulty of identifying small unarmored dinoflagellates. We have established four clonal cultures of K arenia longicanalis isolated from the type locality, Hong Kong harbor(strain HK01) and other three locations along the Chinese coasts(strains YB01, DT01, and NJ01). The morphology of the strain was studied by light and scanning electron microscopy(LM and SEM) and the pigment composition analyzed by high-performance liquid chromatography. We provide the first molecular data of K. longicanalis based on the large subunit(LSU) rRNA gene sequence and internal transcribed spacer(ITS). The four strains showed identical LSU rDNA sequences with a similarity of 99.4% to the holotype of K arenia umbella(strain KUTN05) from Australia. In the ITS phylogeny, the sequence of K. umbella branched between the Chinese strains of K. longicanalis. A careful comparison of the morphology of K. longicanalis and K. umbella reveals the similarity in the diagnostic characters. Diff erences may appear due to the sample treatment for SEM. We conclude that K. umbella is a junior synonym of K. longicanalis.展开更多
Fungi contamination is an important factor affecting the quality and commercial value of fermented milk.Vanillin is known as a safe and efficient natural antimicrobial additive with great potential value as a food bio...Fungi contamination is an important factor affecting the quality and commercial value of fermented milk.Vanillin is known as a safe and efficient natural antimicrobial additive with great potential value as a food bio-preservative.In this study,the microbiological quality of fermented milk of different brands retailed in China and the antimicrobial activity of vanillin were investigated.A total of 27 fermented milk samples were purchased and evaluated.Fungal isolates obtained were characterized by DNA sequencing of the internal transcribed spacer(ITS)region.The effects of vanillin on the growth of fungi were studied by plate dilution method,radical colony diameter,and mycelium biomass.The result showed that 14.8%of the samples were contaminated with three different species of fungi with Cladosporium spp.being the most predominant fungal contaminant.The study further showed that vanillin had significant inhibitory activity against the growth of the fungi species.The cell number,radical colony diameter,and the mycelium biomass of the fungal contaminant were significantly reduced by the inhibitory action of the vanillin.The study thus provides reliable data evidence that will help relevant stakeholders in the fermented milk industries to improve their quality control strategies and consider vanillin as a bio-preservative with the potential to increase the shelf-life and safety of fermented milk.展开更多
Objective:To investigate some morphological and molecular characteristics of fungal parasites isolated from wild tropical bed bug, Cimex hemipterus.Methods: A series of culture methods were used to obtain fungal isola...Objective:To investigate some morphological and molecular characteristics of fungal parasites isolated from wild tropical bed bug, Cimex hemipterus.Methods: A series of culture methods were used to obtain fungal isolates from i eld-collected bed bugs. Characteristics of the isolates such as colony appearance, mycelial texture and pigmentation were studied to explore their morphology. Isolates were also subjected to a PCRbased genotyping test.Results: There were noticeable dif erences in morphological characteristics among the four isolates. Conidial areas of one isolate were dark green, whereas those of the remaining colonies were olive-green, black or dark brown. Conidia of the dark green isolate were globose, while those of olive-green, black and dark brown isolates were globose to subglobose, globose to spherical and globose to subglobose/i nely roughened, respectively. These morphological specii cities and the molecular analyses showed that the fungal internal transcribed spacer ribosomal region and β-tubulin gene sequences of the isolates shared clade with Trichoderma and Aspergillus sequences.Conclusions: Overall, the new discovery of common pathogens in agricultural i eld developed in live bed bugs storage tank may initiate the use of biological agents in later years.展开更多
Filamentous Bangia,which are distributed extensively throughout the world,have simple and similar morphological characteristics.Scientists can classify these organisms using molecular markers in combination with morph...Filamentous Bangia,which are distributed extensively throughout the world,have simple and similar morphological characteristics.Scientists can classify these organisms using molecular markers in combination with morphology.We successfully sequenced the complete nuclear ribosomal DNA.approximately 13 kb in length,from a marine Bangia population.We further analyzed the small subunit ribosomal DNA gene(nrSSU) and the internal transcribed spacer(ITS) sequence regions along with nine other marine,and two freshwater Bangia samples from China.Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences(0-0.003;0-0.006,respectively) from each other,but high divergences(0.123-0.126;0.198,respectively) from freshwater samples.An exception is the marine sample collected from Weihai,which shows high divergence from both other marine samples(0.063-0.065;0.129,respectively) and the freshwater samples(0.097;0.120,respectively).A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades,with the two marine sample clades containing Bangia spp.from North America,Europe,Asia,and Australia;and one freshwater clade,containing Bangia atropurpurea from North America and China.展开更多
The diverse members of the genus Daphne are prized for their fragrant flowers.Despite being promising ornamental plants in many countries,genetic information of Daphne is scarce.In this study,the plastomes of four spe...The diverse members of the genus Daphne are prized for their fragrant flowers.Despite being promising ornamental plants in many countries,genetic information of Daphne is scarce.In this study,the plastomes of four species and one variety of Daphne were sequenced and analyzed.The plastomes were typical and contained a pair of inverted repeat(IR)regions that separated the large single-copy(LSC)region from the small single-copy(SSC)region.With a length ranging from 132,869 bp(D.genkwa)to 174,773 bp(D.championii),106 to 141 genes were predicted.Comparative plastome analysis of the newly sequenced plastomes with four publicly available Daphne plastomes identified an expansion of the IRs,sequence variations,and mutational hotspots.Phylogenetic analyses indicated that the genus Daphne in its current circumscription is polyphyletic.Daphne genkwa was nested within the genus Wikstroemia,while D.championii was well resolved as sister to Edgeworthia.These findings concurred with results from our study that used nuclear ribosomal internal transcribed spacer sequence data.The conflicts on the molecular placement of D.championii and D.genkwa and the present taxonomic classification in Daphne suggest that a new intergeneric classification system of Daphneae warrants consideration.展开更多
Dumasia taxonomy and classification have long been problematic.Species within this genus have few morphological differences and plants without flowers or fruits are difficult to accurately identify.In this study,we ev...Dumasia taxonomy and classification have long been problematic.Species within this genus have few morphological differences and plants without flowers or fruits are difficult to accurately identify.In this study,we evaluated the ability of six DNA barcoding sequences,one nuclear(ITS)and five chloroplast regions(trnH-psbA,matK,rbcL,trnL-trnF,psbB-psbF),to efficiently identify Dumasia species.Most single markers or their combinations identify obvious barcoding gaps between intraspecific and interspecific genetic variation.Most combined analyses including ITS showed good species resolution and identification efficiency.We therefore suggest that ITS alone or a combination of ITS with any cpDNA marker are most suitable for DNA barcoding of Dumasia.The phylogenetic analyses clearly indicated that Dumasia yunnanensis is not monophyletic and is separated as two independent branches,which may result from cryptic differentiation.Our results demonstrate that molecular data can deepen the comprehension of taxonomy of Dumasia and provide an efficient approach for identification of the species.展开更多
Although intestinal fungi play important roles in host health and disease,the composition and diversity of fungal communities remain poorly reported in fish.In this study,fungi in the fore-,mid-,and hindintestine of t...Although intestinal fungi play important roles in host health and disease,the composition and diversity of fungal communities remain poorly reported in fish.In this study,fungi in the fore-,mid-,and hindintestine of tilapia(Oreochromis mossambicus)and bighead carp(Aristichthys nobilis)from Hongchaojiang Reservoir in Guangxi,China were investigated by ITS sequencing.Based on this,we obtained 1763478 high-quality tags,which clustered into 1089 operational taxonomic units(OTUs).In total,404 OTUs were annotated,of which 310,68,and 26 belonged to Ascomycota,Basidiomycota,and other,respectively.Results show significant differences in the community composition of intestinal fungi between tilapia and bighead carp but not within their different intestinal segments.Furthermore,154 of the 404 annotated OTUs were considered reliable and were classified into three trophic modes and nine guilds.The three trophic modes consisted of 108 OTUs of saprotrophic fungi,41 OTUs of pathotrophic fungi,and five OTUs of symbiotrophic fungi.The top three most abundant OTUs overall(i.e.,Otu000002,Scopulariopsis acremonium;Otu000018,Alternaria palandui;Otu000034,Aureobasidium pullulans)showed lower abundance in the hind-intestinal segments of bighead carp,suggesting uneven distribution of these fungi in this species.In addition,saprotrophic and pathotrophic fungi were markedly decreased in the hindintestine.It is indicated that the fungal community was not only related to host species specificity but also to the respective physiological functions of different intestinal segments.These findings provide valuable information on the composition,structure,and potential function of the intestinal fungi community associated with different intestinal segments in tilapia and bighead carp under natural conditions,thus highlighting the importance of fungi as an integral part of the inte stinal microbiota in maintaining host health.展开更多
基金Supported by National Natural Science Foundation of China,No.81672379 and No.81101858Natural Science Foundation of Shandong Province,China,No.ZR2016HM16.
文摘Gastric cancer(GC)is the fourth leading cause of cancer-related death.The occurrence and development of GC is a complex process involving multiple biological mechanisms.Although traditional regulation modulates molecular functions related to the occurrence and development of GC,the comprehensive mechanisms remain unclear.Ultraconserved region(UCR)refers to a genome sequence that is completely conserved in the homologous regions of the human,rat and mouse genomes,with 100%identity,without any insertions or deletions,and often located in fragile sites and tumour-related genes.The transcribed UCR(T-UCR)is transcribed from the UCR and is a new type of long noncoding RNA.Recent studies have found that the expression level of T-UCRs changes during the occurrence and development of GC,revealing a new mechanism underlying GC.Therefore,this article aims to review the relevant research on T-UCRs in GC,as well as the function of T-UCRs and their regulatory role in the occurrence and development of GC,to provide new strategies for GC diagnosis and treatment.
文摘Fungus-growing termites cultivate species of the mutualistic basidiomycete genus Termitomyces on a substrate called the fungal comb. Identification of fungal species based on morphological features is complicated, tedious, and prone to errors. As an alternative, nuclear ribosomal DNA sequences consisting of the internal transcribed spacers (ITS1 and ITS2) and 5.8S rDNA were used to identify Malaysian isolates of Termitomyces sp. The morphological characteristics and molecular data indicate that Malaysian Termitomyces isolated is clearly monophyletic and belongs to the Tricholomataceae family. The Malaysian isolates analyzed in this study represent the termite fungus species called T. aurantiacus.
文摘Ricinus communis have attracted considerable attention because of its specific industrial and pharmacological activities. DNA barcodes can be used as reliable tools to facilitate the identification of medicinal plants for the safe use, quality control and forensic investigation. In this study, the differential identification of eight accessions of R. com-munis was investigated through DNA sequence analysis of two candidate DNA barcodes. The nucleotide sequence of internal transcribed spacers (ITS2) and chloroplast maturase gene (matK) have been determined to construct the phylogenetic tree. The phylogenetic relationships of accessions based on the nrITS2 region and partial matK region showed that all accessions in this study were related to three geographical origins. Based on sequence align-ment and phylogenetic analyses we concluded that the ITS2 sequences can distinguish R. communis accessions from different geographical distributions.
基金Supported by the Natural Science Foundation of Beijing, China (Grant No. 7052009)the National Natural Science Foundation of China (Grant No. 30470243)
文摘To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.
文摘Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
基金supported by the base funding (Grant No. BAS/1/1606-01-01) to VBB by the King Abdullah University of Science and Technology (KAUST), Saudi Arabia
文摘In mammalian cells, transcribed enhancers(TrEns) play important roles in the initiation of gene expression and maintenance of gene expression levels in a spatiotemporal manner. One of the most challenging questions is how the genomic characteristics of enhancers relate to enhancer activities. To date, only a limited number of enhancer sequence characteristics have been investigated, leaving space for exploring the enhancers' DNA code in a more systematic way. To address this problem, we developed a novel computational framework, Transcribed Enhancer Landscape Search(TELS), aimed at identifying predictive cell type/tissue-specific motif signatures of TrEns.As a case study, we used TELS to compile a comprehensive catalog of motif signatures for all known TrEns identified by the FANTOM5 consortium across 112 human primary cells and tissues.Our results confirm that combinations of different short motifs characterize in an optimized manner cell type/tissue-specific TrEns. Our study is the first to report combinations of motifs that maximize classification performance of TrEns exclusively transcribed in one cell type/tissue from TrEns exclusively transcribed in different cell types/tissues. Moreover, we also report 31 motif signatures predictive of enhancers' broad activity. TELS codes and material are publicly available at http://www.cbrc.kaust.edu.sa/TELS.
基金University Grant Commission,New Delhi (India) for financial support (Award letter No.20-12/2009(ii) EU-IV)
文摘Shankhpushpi is a reputed drug from an Indian system of medicine for treating mental disorders and enhancing memory. Two herbs, namely Convolvulus prostratus Forssk. and Evolvulus alsinoides(L.) L., are commonly known as Shankhpushpi. Ambiguous vernacular identity can affect the scientific validity of the Shankpushpi-based herbal drug therapy. In the present investigation, a novel and sensitive multiplex PCR method based on polymorphism in the internal transcribed spacer(ITS) region was developed to establish the molecular identity of C. prostratus and E. alsinoides. DNA was isolated and the ITS region was amplified, sequenced and assembled. Sequences were aligned to identify variable nucleotides in order to develop plant-specific primers. Primers were validated in singleplex reactions and eventually a multiplex assay was developed. This assay was tested for sensitivity and validated by amplifying DNA isolated from the simulated blended powdered plant material. Primers developed for C. prostratus resulted into a 200 bp amplicon and 596 bp for E. alsinoides. The assay was found to be sensitive enough for amplification of low quantities of DNA. The method can detect 10% of the mixing of plants with each other in blended material. This PCR assay can be used for rapid botanical identification of Shankhpushpi plant materials and will improve evidence-based herbal drug therapy.
基金financially supported by the Ministry of Science and Technology of China(2011CB100600,2011AA100205)the National Natural Science Foundation of China(NSFC)
文摘A large number of expressed sequences tags are available for Citrus spp., which provides an opportunity to understand genomic organization of the transcribed regions. Here, we report a detailed analysis of repetitive elements including tandem repeats(TRs) and transposable elements(TEs) in the transcribed region of the Citrus spp.On average, 22% of the expressed sequence tags(ESTs)contain TRs. The relative density of TR classes is highly taxon-specific. For instance, Citrus limonia has a high relative density of mononucleotide repeats, whereas dinucleotide repeats are rare. The proportions of 2–6,7–30 and 31–50 bp repeats were almost identical in all studied species except for C. limonia and C. limettioides.We found that < 1% of the citrus ESTs have a similarity with transposable elements. Transcriptional activity of transposable element families varied even within the same class of elements. A high proportion of transcriptional activity was observed for gypsy-like TEs compare to other TE classes. While TEs are relatively rare, TRs are abundant elements in ESTs of citrus. The high proportion of TRs that have a unit size longer than 6 bp raises the question about a possible functional or evolutionary role of these elements.
基金Supported by Office of the Higher Education CommissionThailand+1 种基金University of Phayao and CU Graduate School Thesis GrantChulalongkorn University (Grant No.5200601)
文摘Objective:To distinguish the difference among the Clinacanthus nutans(Burm.f.)Lindau(C.nutans)and Clinacanthus siamensis Bremek(C.siamensis)by assessing pharmacognosy characteristics,molecular aspect and also to evaluate their anti-herpes simplex virus(HSV)type 1 and type 2 activities.Methods:Macroscopic and microscopic evaluation were performed according to WHO Geneva guideline.Stomatal number,stomatal index and palisade ratio of leaves were evaluated.Genomic DNA was extracted by modified CTAB method and ITS region was amplified using PGR and then sequenced.Dry leaves were subsequently extracted with n-hexane,dichloromethane and methanol and antiviral activity was performed using plaque reduction assay and the cytotoxicity of the extracts on Vero cells was determined by MTT assay.Results:Cross section of midrib and stem showed similar major components.Leaf measurement index of stomatal number,stomatal index and palisade ratio of C.nutans were 168.32±29.49,13.83±0.86 and 6.84±0.66,respectively,while C.siamensis were 161.60±18.04,11.93±0.81and 3.37±0.31,respectively.The PCR amplification of ITS region generated the PGR product approximately 700 bp in size.There were 34 polymorphisms within the ITS region which consisted of 11 Indels and 23 nucleotide substitutions.The IC_(50)values of C.nutans extracted with n-hexane,dichloromethane and methanol against HSV-1 were(32.05±3.63)μg/mL,(44.50±2.66)μg/mL,(64.93±7.00)μg/mL,respectively where as those of C.siamensis were(60.00±11.61)μg/mL,(55.69+4.41)μg/mL,(37.39±5.85)μg/mL,respectively.Anti HSV-2 activity of n-hexane,dichloromethane and methanol C.nutans leaves extracts were(72.62±12.60)μg/mL,(65.19±21.45)μg/mL,(65.13±2.22)μg/mL,respectively where as those of C.siamensis were(46.52±4.08)μg/mL,(49.63±2.59)μg/mL,(72.64±6.52)μg/mL,respectively.Conclusions:The combination of macroscopic,microscopic and biomolecular method are able to authenticate these closely related plants and both of them have a potency to be an anti-HSV agent.
基金Supported by the Youth Backbone Training Plan of the Beijing Academy of Science and Technology(No.201602)the National Nature Science Foundation of China(No.41606175,41576162)+1 种基金the National Key R&D Program of China(No.2017YFC1404301)the Strategic Priority Research Program of the Chinese Academy of Sciences(No.XDA1102030401)
文摘The dinoflagellate genus K arenia is known for recurrent harmful blooms worldwide. However, species diversity of the genus is generally overlooked owing to the difficulty of identifying small unarmored dinoflagellates. We have established four clonal cultures of K arenia longicanalis isolated from the type locality, Hong Kong harbor(strain HK01) and other three locations along the Chinese coasts(strains YB01, DT01, and NJ01). The morphology of the strain was studied by light and scanning electron microscopy(LM and SEM) and the pigment composition analyzed by high-performance liquid chromatography. We provide the first molecular data of K. longicanalis based on the large subunit(LSU) rRNA gene sequence and internal transcribed spacer(ITS). The four strains showed identical LSU rDNA sequences with a similarity of 99.4% to the holotype of K arenia umbella(strain KUTN05) from Australia. In the ITS phylogeny, the sequence of K. umbella branched between the Chinese strains of K. longicanalis. A careful comparison of the morphology of K. longicanalis and K. umbella reveals the similarity in the diagnostic characters. Diff erences may appear due to the sample treatment for SEM. We conclude that K. umbella is a junior synonym of K. longicanalis.
基金the Jiangsu Agricultural Industry Technology System(No JATS-2018-296).
文摘Fungi contamination is an important factor affecting the quality and commercial value of fermented milk.Vanillin is known as a safe and efficient natural antimicrobial additive with great potential value as a food bio-preservative.In this study,the microbiological quality of fermented milk of different brands retailed in China and the antimicrobial activity of vanillin were investigated.A total of 27 fermented milk samples were purchased and evaluated.Fungal isolates obtained were characterized by DNA sequencing of the internal transcribed spacer(ITS)region.The effects of vanillin on the growth of fungi were studied by plate dilution method,radical colony diameter,and mycelium biomass.The result showed that 14.8%of the samples were contaminated with three different species of fungi with Cladosporium spp.being the most predominant fungal contaminant.The study further showed that vanillin had significant inhibitory activity against the growth of the fungi species.The cell number,radical colony diameter,and the mycelium biomass of the fungal contaminant were significantly reduced by the inhibitory action of the vanillin.The study thus provides reliable data evidence that will help relevant stakeholders in the fermented milk industries to improve their quality control strategies and consider vanillin as a bio-preservative with the potential to increase the shelf-life and safety of fermented milk.
基金Supported by Universiti Sains Malaysia(Short Term Grant:304/PBIOLOGI/6313030)
文摘Objective:To investigate some morphological and molecular characteristics of fungal parasites isolated from wild tropical bed bug, Cimex hemipterus.Methods: A series of culture methods were used to obtain fungal isolates from i eld-collected bed bugs. Characteristics of the isolates such as colony appearance, mycelial texture and pigmentation were studied to explore their morphology. Isolates were also subjected to a PCRbased genotyping test.Results: There were noticeable dif erences in morphological characteristics among the four isolates. Conidial areas of one isolate were dark green, whereas those of the remaining colonies were olive-green, black or dark brown. Conidia of the dark green isolate were globose, while those of olive-green, black and dark brown isolates were globose to subglobose, globose to spherical and globose to subglobose/i nely roughened, respectively. These morphological specii cities and the molecular analyses showed that the fungal internal transcribed spacer ribosomal region and β-tubulin gene sequences of the isolates shared clade with Trichoderma and Aspergillus sequences.Conclusions: Overall, the new discovery of common pathogens in agricultural i eld developed in live bed bugs storage tank may initiate the use of biological agents in later years.
基金Supported by the National Natural Science Foundation of China(Nos.31270256,41276134)the National High Technology Research and Development Program of China(863 Program)(No.2012AA10A406-6)
文摘Filamentous Bangia,which are distributed extensively throughout the world,have simple and similar morphological characteristics.Scientists can classify these organisms using molecular markers in combination with morphology.We successfully sequenced the complete nuclear ribosomal DNA.approximately 13 kb in length,from a marine Bangia population.We further analyzed the small subunit ribosomal DNA gene(nrSSU) and the internal transcribed spacer(ITS) sequence regions along with nine other marine,and two freshwater Bangia samples from China.Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences(0-0.003;0-0.006,respectively) from each other,but high divergences(0.123-0.126;0.198,respectively) from freshwater samples.An exception is the marine sample collected from Weihai,which shows high divergence from both other marine samples(0.063-0.065;0.129,respectively) and the freshwater samples(0.097;0.120,respectively).A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades,with the two marine sample clades containing Bangia spp.from North America,Europe,Asia,and Australia;and one freshwater clade,containing Bangia atropurpurea from North America and China.
基金supported by the Fundamental Research Funds for the Central Universities(33000-31611215)the Guangzhou Science and Technology Program(201903010076)the National Natural Science Foundation of China(31760048).
文摘The diverse members of the genus Daphne are prized for their fragrant flowers.Despite being promising ornamental plants in many countries,genetic information of Daphne is scarce.In this study,the plastomes of four species and one variety of Daphne were sequenced and analyzed.The plastomes were typical and contained a pair of inverted repeat(IR)regions that separated the large single-copy(LSC)region from the small single-copy(SSC)region.With a length ranging from 132,869 bp(D.genkwa)to 174,773 bp(D.championii),106 to 141 genes were predicted.Comparative plastome analysis of the newly sequenced plastomes with four publicly available Daphne plastomes identified an expansion of the IRs,sequence variations,and mutational hotspots.Phylogenetic analyses indicated that the genus Daphne in its current circumscription is polyphyletic.Daphne genkwa was nested within the genus Wikstroemia,while D.championii was well resolved as sister to Edgeworthia.These findings concurred with results from our study that used nuclear ribosomal internal transcribed spacer sequence data.The conflicts on the molecular placement of D.championii and D.genkwa and the present taxonomic classification in Daphne suggest that a new intergeneric classification system of Daphneae warrants consideration.
基金We thank Dr.Zhi-qiang Lu and Mr.Yi Fu for help during the field survey.We are grateful to Dr.Ovidiu Paun for very helpful comments on earlier drafts of this manuscript.We thank Dr.Shu-feng Li for the distributional map,as well as Dr.Bing Liu,Dr.Ren-bin Zhu,and Mr.Yi Fu for their photos of some Dumasia species.The first author thanks Dr.Wen-bin Yu,Dr.Pei-liang Liu,Dr.Xue-li Zhao,and Dr.Zhu-qiu Song for their help during the writing process.Additional thanks go to Dr.Richard T.Corlett,Raymond Porter and Mr Yuan-qiong Zhang for polishing this work.The authors would also like to express gratitude to two anonymous reviewers for their valuable comments on the manuscript.This work was financially supported by the Second Tibetan Plateau Scientific Expedition and Research(STEP)program(2019QZKK0502)National Natural Science Foundation of China(NSFC 41861008)the 135 Karst‘breakthrough’project Grant 2017XTBG-T03.
文摘Dumasia taxonomy and classification have long been problematic.Species within this genus have few morphological differences and plants without flowers or fruits are difficult to accurately identify.In this study,we evaluated the ability of six DNA barcoding sequences,one nuclear(ITS)and five chloroplast regions(trnH-psbA,matK,rbcL,trnL-trnF,psbB-psbF),to efficiently identify Dumasia species.Most single markers or their combinations identify obvious barcoding gaps between intraspecific and interspecific genetic variation.Most combined analyses including ITS showed good species resolution and identification efficiency.We therefore suggest that ITS alone or a combination of ITS with any cpDNA marker are most suitable for DNA barcoding of Dumasia.The phylogenetic analyses clearly indicated that Dumasia yunnanensis is not monophyletic and is separated as two independent branches,which may result from cryptic differentiation.Our results demonstrate that molecular data can deepen the comprehension of taxonomy of Dumasia and provide an efficient approach for identification of the species.
基金the Guangxi Science and Technology Major Project(No.AA17204095-8)the Open Fund of Guangxi Key Laboratory of Aquatic Genetic Breeding and Healthy Aquaculture(No.GXKEYLA2019-05)the China-ASEAN Maritime Cooperation Fund(No.CAMC-2018F)。
文摘Although intestinal fungi play important roles in host health and disease,the composition and diversity of fungal communities remain poorly reported in fish.In this study,fungi in the fore-,mid-,and hindintestine of tilapia(Oreochromis mossambicus)and bighead carp(Aristichthys nobilis)from Hongchaojiang Reservoir in Guangxi,China were investigated by ITS sequencing.Based on this,we obtained 1763478 high-quality tags,which clustered into 1089 operational taxonomic units(OTUs).In total,404 OTUs were annotated,of which 310,68,and 26 belonged to Ascomycota,Basidiomycota,and other,respectively.Results show significant differences in the community composition of intestinal fungi between tilapia and bighead carp but not within their different intestinal segments.Furthermore,154 of the 404 annotated OTUs were considered reliable and were classified into three trophic modes and nine guilds.The three trophic modes consisted of 108 OTUs of saprotrophic fungi,41 OTUs of pathotrophic fungi,and five OTUs of symbiotrophic fungi.The top three most abundant OTUs overall(i.e.,Otu000002,Scopulariopsis acremonium;Otu000018,Alternaria palandui;Otu000034,Aureobasidium pullulans)showed lower abundance in the hind-intestinal segments of bighead carp,suggesting uneven distribution of these fungi in this species.In addition,saprotrophic and pathotrophic fungi were markedly decreased in the hindintestine.It is indicated that the fungal community was not only related to host species specificity but also to the respective physiological functions of different intestinal segments.These findings provide valuable information on the composition,structure,and potential function of the intestinal fungi community associated with different intestinal segments in tilapia and bighead carp under natural conditions,thus highlighting the importance of fungi as an integral part of the inte stinal microbiota in maintaining host health.
