Pharmaceutical delivery systems are developed to improve the physicochemical properties of therapeutic compounds. Emulsions are one of these drug delivering systems formulated using water, oils and lipids as main ingr...Pharmaceutical delivery systems are developed to improve the physicochemical properties of therapeutic compounds. Emulsions are one of these drug delivering systems formulated using water, oils and lipids as main ingredients. Extensive data are usually generated on the physical and chemical characteristics of these oil-in-water and lipid emulsions. However, the oxidative tendency of emulsions is often overlooked. Oxidation impacts the overall quality and safety of these pharmaceutical emulsions. Additionally, introducing oxidatively unstable emulsions into biological systems further promotes oxidation in situ. Products of these reactions then continue to pose serious harm to cells and fuel other physiological oxidation reactions. Consequently, the increase of oxidation products leads to oxidative damage to biological systems. Thus, emulsions with lower lipid peroxidation are more stable and will reduce the negative effects of oxidation in situ. Preventive measures during the formulation of emulsions are important. Many naturally occurring and cost effective substances possess low oxidation tendencies and confer oxidative protection when used in emulsions. Additionally,certain preparatory methods should be employed to reduce or better control lipid peroxidation.Finally, emulsions must be evaluated for their oxidation susceptibility using the various techniques available. Careful attention to the preparation of emulsions and assessment of their oxidative stability will help produce safer emulsions without compromising efficacy.展开更多
Detection of oil pollution in soil has been carried out using laser-induced breakdown spectroscopy(LIBS). A pulsed neodymium-doped yttrium aluminum garnet(Nd:YAG) laser(1,064 nm, 8 ns, 200 mJ) was focused onto pelleti...Detection of oil pollution in soil has been carried out using laser-induced breakdown spectroscopy(LIBS). A pulsed neodymium-doped yttrium aluminum garnet(Nd:YAG) laser(1,064 nm, 8 ns, 200 mJ) was focused onto pelletized soil samples. Emission spectra were obtained from oil-contaminated soil and clean soil. The contaminated soil had almost the same spectrum profile as the clean soil and contained the same major and minor elements. However, a C–H molecular band was clearly detected in the oil-contaminated soil, while no C–H band was detected in the clean soil. Linear calibration curve of the C–H molecular band was successfully made by using a soil sample containing various concentrations of oil. The limit of detection of the C–H band in the soil sample was 0.001 mL/g. Furthermore, the emission spectrum of the contaminated soil clearly displayed titanium(Ti) lines, which were not detected in the clean soil. The existence of the C–H band and Ti lines in oil-contaminated soil can be used to clearly distinguish contaminated soil from clean soil. For comparison, the emission spectra of contaminated and clean soil were also obtained using scanning electron microscope-energy dispersive X-ray(SEM/EDX) spectroscopy,showing that the spectra obtained using LIBS are much better than using SEM/EDX, as indicated by the signal to noise ratio(S/N ratio).展开更多
John Milton introduces the Biblical world into literature. Some modern critics think that in Paradise Lost, Milton makes Satan a hero while God a tyrant, yet, adopting the original Biblical perception, the reader will...John Milton introduces the Biblical world into literature. Some modern critics think that in Paradise Lost, Milton makes Satan a hero while God a tyrant, yet, adopting the original Biblical perception, the reader will see the "Eternal Providence" of God and will agree that Milton has succeeded in justifying God as a Father Who says "Man Shall Find Grace". A Biblical reading of this epic will be done by focusing on its detail contents.展开更多
Objective: To investigate the bioactive components of Sangqi Qingxuan formula(SQQX), predict the pharmacological targets, and explore the mechanism of hypertensive vascular remodeling(HVR).Methods: Network pharmacolog...Objective: To investigate the bioactive components of Sangqi Qingxuan formula(SQQX), predict the pharmacological targets, and explore the mechanism of hypertensive vascular remodeling(HVR).Methods: Network pharmacology was adopted to predict how SQQX acts in HVR. The effectiveness was assessed by blood pressure measurements and pathological morphology observation based on a spontaneously hypertensive rat model, while the mechanism of SQQX on HVR was validated by immunohistochemistry(IHC) and western blot(WB) according to the results of network pharmacology.Results: There were 130 bioactive components of SQQX and 231 drug targets predicted by the Traditional Chinese Medicine Systems Pharmacology Database. Subsequently, 181 common targets were identified for SQQX against HVR, with TP53, MAPK1, and AKT1 as the core targets. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses was employed to identify the top 20 enriched functions and the top 20 pathways(P <.01). Finally, the key role of the ERK/MAPK signaling pathway in HVR was determined. The in vivo results suggested that SQQX reduced systolic blood pressure and increased the ratio of thoracic aortic wall thickness to lumen diameter. Additionally, compared with the model group, SQQX increased the expression of smooth muscle 22 alpha(IHC: P <.001;WB:P <.05) and decreased the expression of osteopontin(IHC: P <.001;WB: P <.05), ERK1/2(IHC: P <.001;WB: ERK1 & ERK2, all P <.05), p-ERK1/2(IHC: P <.001;WB: ERK1 & ERK2, all P <.05), and the ratio of pERK1/2 to ERK1/2 protein(IHC: P <.001).Conclusions: SQQX, which has multiple bioactive ingredients and potential targets, is an effective treatment for HVR. The mechanism of antihypertensive and vascular protection may be related to the inhibition of phenotypic transformation of vascular smooth muscle cells and the ERK/MAPK signaling pathway.展开更多
Objective: To assess the effectiveness and safety of manipulation intervention for degenerative lumbar spondylolisthesis(DLS).Methods: This is a systematic review and meta-analysis. A full-scale retrieval method was p...Objective: To assess the effectiveness and safety of manipulation intervention for degenerative lumbar spondylolisthesis(DLS).Methods: This is a systematic review and meta-analysis. A full-scale retrieval method was performed until February 1, 2021, including nine databases. The homogeneity of different studies was summarized using the Review Manager. The quality of studies was determined with the Cochrane risk-of-bias tool.The evidence quality was graded with the Grading of Recommendations, Assessment, Development, and Evaluations approach.Results: A total of 6 studies involving 524 participants were included. The review demonstrated that manipulation has statistically significant improvements for treating DLS according to Japanese Orthopedic Association scores(mean difference, 3.76;95% confidence interval, 2.63 to 4.90;P <.001) and visual analog scale scores(mean difference,-1.50;95% confidence interval,-1.66 to-1.33;P <.001)compared to the control group. One study reported that the difference in the Oswestry Disability Index between the traction group and the combination of manipulation and traction group was statistically significant(P <.05), while another reported that manipulation treatment can significantly improve the lumbar spine rotation angle on X-ray images compared with the baseline data(P <.05). Moreover, the manipulation group(experimental group) had fewer adverse events than the lumbar traction group(control group).Conclusion: Manipulation intervention is more effective and safer for DLS. Nevertheless, large-scale randomized controlled trials are required to confirm the current conclusions.展开更多
Objective:Penile neoplasia,usually of squamous histogenesis,is currently classfied into human papillomavirus(HPV)-related or-dependent and non-HPV-related or-indepen dent.There are distinct morphological differences a...Objective:Penile neoplasia,usually of squamous histogenesis,is currently classfied into human papillomavirus(HPV)-related or-dependent and non-HPV-related or-indepen dent.There are distinct morphological differences among the two groups.New research studies on penile cancer from Northern countries showed that the presence of HPV is corre lated with a better prognosis than virus negative people,while studies in Southern countries had not confirmed,perhaps due to differences in staging or treatment.Methods:We focused on the description of the HPV.related carcinomas of the penis.The approach was to describe common clinical features followed by the pathological features of each entity or subtype stressing the characteristics for differential diagnosis,HPV genotypes,and prognostic features of the invasive carcinomas.Similar structure was followed for penile intraepithelial neoplasia,except for prognosis because of the scant evidence available.Results:Most of HPV-related lesions can be straightforwardly recognized by routine hematoxylin and eosin stains,but in some cases surrogate p16 immunohistochemical staining or molecular methods such as in situ hybridization or polymerase chain reaction can be utilized.Currently,there are eight tumor invasive variants associated with HPV,as follows:basaloid,warty,warty-basaloid,papillary basaloid,clear cell,medullary,lymphoepithelioma-like,and giant condylomas with malignant transformation.Conclusion:This review presents and describes the heterogeneous clinical,morphological,and genatypic features of the HPV-related subtypes of invasive and non-invasive penile neoplasia.展开更多
Objective:To provide guidelines for the prevention of post-stroke dementia,we investigated whether stroke patients were aware of post-stroke dementia and their level of dementia-related knowledge.Methods:Five dementia...Objective:To provide guidelines for the prevention of post-stroke dementia,we investigated whether stroke patients were aware of post-stroke dementia and their level of dementia-related knowledge.Methods:Five dementia-related questions were designed.A field survey was conducted in a questionand-answer method using the designed questions.The surveys assessed 3000 stroke patients(2 weekse6 months after stroke attacks)from 14 hospitals/clinical centers in 7 provinces and cities across China.Results:Among 3000 stroke patients,80.5%had heard of dementia,39.1%knew that stroke can lead to dementia,55.7%believed dementia can be prevented,50.8%thought dementia can be cured,and only 8.8%had ever seen a doctor because of memory deterioration.Then,patients were classified into three groups,including a no cognitive impairment(NCI)group,a mild cognitive impairment(MCI)group,and a mild dementia(MD)group.Among the MCI and MD groups,only 8.7%(75/861)and 9.9%(64/649)of patients,respectively,had ever seen a doctor because of memory deterioration.According to our results,patients with a higher level of cognitive impairment had a lower awareness of dementia(P<.001).Conclusion:The awareness of dementia in stroke patients in China is low,and the consultation rate is even lower.Moreover,patients with a higher level of cognitive impairment have a lower awareness of dementia.To improve public awareness and improve prevention,more emphasis should be put on education regarding post-stroke dementia.Routine cognitive function screening should be conducted on stroke patients as an effective way to assess dementia.展开更多
Objective:To initially explore traditional Chinese medicine patterns in a bleomycin-induced pulmonary fibrosis mouse model.Methods:Thirty-six C57BL/6 mice were divided by the random number table method(with 12 rats pe...Objective:To initially explore traditional Chinese medicine patterns in a bleomycin-induced pulmonary fibrosis mouse model.Methods:Thirty-six C57BL/6 mice were divided by the random number table method(with 12 rats per group)into three groups:a blank group,a model group,and a number 2 Feibi recipe(FBR-2)group.The pulmonary fibrosis mouse model was established by intratracheal instillation of bleomycin.The FBR-2 group was treated with FBR-2 for 4 weeks.Symptoms in the mice such as mental behavior,food/water intake,body weight,body temperature,respiratory rate,and tongue image were observed.The samples were collected on the 14th day and 28th day after modeling,and lung tissues were visually assessed and microscopically evaluated by staining with hematoxylin-eosin and Masson.The expression levels of hydroxyproline,interleukin(IL)-33,IL-37,tissue plasminogen activator,and plasminogen activator inhibitor-1 were determined by enzyme-linked immunosorbent assay.Results:Mice in the model group were poor in spirit,less active,slow in response,showed reduced food/water intake,body temperature,and body weight,increased respiratory rate,and their tongue color had changed from light red to dark red.However,treatment with FBR-2 significantly improved these symptoms.Extensive inflammatory cell infiltration and collagen fiber deposition were observed in the lung tissues of the model group.Compared with the blank group,the levels of hydroxyproline,IL-33,and plasminogen activator inhibitor-1 in the model group significantly increased(all P<.05),whereas that of tissue plasminogen activator significantly decreased on the 14th day and 28th day(P=.036 and P=.005,respectively).Moreover,FBR-2 improved lung inflammation and fibrinolysis imbalance and reduced collagen fiber deposition.Conclusion:To some extent,our bleomycin-induced pulmonary fibrosis mouse model exhibited traditional Chinese medicine patterns of qi deficiency,blood stasis,and heat retention.展开更多
Differentiated embryonic stem cells (ESC) can ameliorate lung inflammation and fibrosis in animal lung injury models;therefore, ESC, or their products, could be candidates for regenerative therapy for incurable lung d...Differentiated embryonic stem cells (ESC) can ameliorate lung inflammation and fibrosis in animal lung injury models;therefore, ESC, or their products, could be candidates for regenerative therapy for incurable lung diseases, such as idiopathic pulmonary fibrosis (IPF). In this study, we have investigated the paracrine effect of differentiated and undifferentiated human ESC on alveolar epithelial cell (AEC) wound repair. hESC line, SHEF-2 cells were differentiated with Activin treatment for 22 days in an embryoid body (EB) suspension culture. Conditioned media (CM) which contain cell secretory factors were collected at different time points of differentiation. CM were then tested onin vitro?wound repair model with human type II AEC line, A549 cells (AEC). Our study demonstrated that CM originated from undifferentiated hESC significantly inhibited AEC wound repair when compared to the control. Whereas, CM originated from Activin-directed hESC differentiated cell population demonstrated a differential reparative effect on AEC wound repair model. CM obtained from Day-11 of differentiation significantly enhanced AEC wound repair in comparison to CM collected from pre- and post-Day-11 of differentiation. Day-11 CM enhanced AEC wound repair through significant stimulation of cell migration and cell proliferation. RT-PCR and immunocytochemistry confirmed that Day-11 CM was originated form a mixed population of endodermal/mesodermal differentiated hESC. This report suggests a putative paracrine-mediated epithelial injury healing mechanism by hESC secreted products, which is valuable in the development of novel stem cell-based therapeutic strategies.展开更多
Objective:To evaluate the effects of Liuzijue respiratory exercise in patients with chronic obstructive pulmonary disease(COPD).Method:Randomly controlled trials of Liuzijue respiratory exercise in the treatment of CO...Objective:To evaluate the effects of Liuzijue respiratory exercise in patients with chronic obstructive pulmonary disease(COPD).Method:Randomly controlled trials of Liuzijue respiratory exercise in the treatment of COPD were searched in the database,including PubMed,Embase,Web of Science,Cochrane Library,CNKI,Wanfang,CBM,and VIP.Study screening,data extraction,and quality assessment were conducted by two researchers independently.Data were analyzed using RevMan 5.3 software.Results:11 studies with 915 COPD patients were included.Results of meta-analysis showed that compared with conventional care,Liuzijue respiratory exercise had shown better effects on FEV1(Forced expiratory volume in 1 second)[MD=0.18,95%CI(0.06,0.30),P=0.004],FEV1%pred[MD=10.21,95%CI(7.25,13.18),P<0.001],FEV1/FVC%(Forced vital capacity)[MD=8.32,95%CI(3.23,13.40),P<0.001],6-minute walk distance[MD=10.97,95%CI(5.81,16.12),P<0.001]and life quality[MD=-10.07,95%CI(-12.84,-7.30),P<0.001].However,no difference was observed in the effective rate between these two groups.Compared with whole body respiratory exercise,except for the better effects on 6-minute walk distance[MD=37.82,95%CI(6.51,69.13),P=0.02],no difference in FEV1,FEV1%pred,FEV1/FVC%and life quality were observed between these two groups.Conclusion:Liuzijue respiratory exercise can better improve lung function,functional capacity,and life quality of COPD patients compared with conventional care.Compared with the whole body respiratory exercise,Liuzijue could improve the functional capacity of COPD patients significantly and showed similar effcets on lung function and life quality.展开更多
<strong>Introduction: </strong>Erectile dysfunction (ED) is a common complication of diabetes mellitus (DM) that is associated with poor quality of life and can be present in type 2 diabetics at the time o...<strong>Introduction: </strong>Erectile dysfunction (ED) is a common complication of diabetes mellitus (DM) that is associated with poor quality of life and can be present in type 2 diabetics at the time of diagnosis. There are common risk factors associated with erectile dysfunction in type 2 diabetic subjects. Some of these are potentially treatable or reversible. The risk factors evaluated by this study included glycaemic control, duration of diabetes, obesity, peripheral artery disease (PAD), hypertension and antihypertensive medications use. <strong>Materials and Methods:</strong> This study was a cross sectional one carried out over a period of six months (June-November, 2016) at the diabetes clinic of the Nnamdi Azikiwe University Teaching Hospital, Nnewi and involved 124 subjects with type 2 diabetes mellitus. A convenience sampling method was used. A detailed physical examination, blood pressure and anthropometric measurements and vascular assessment with a hand-held doppler ultrasound were carried out. Data was collected using a study proforma. Erectile dysfunction was diagnosed with the International Index of Erectile Function questionnaire while anxiety and depression were diagnosed with the Hospital Anxiety and Depression questionnaires. Subjects that had anxiety/depression or hypogonadism were excluded from the study. <strong>Results:</strong> A total of 124 subjects were studied, 48.4% of whom had erectile dysfunction. Glycaemic control was significantly associated with ED among the subjects (OR = 0.198, 95% CI = 0.081 - 0.483, P < 0.001). Similarly, peripheral artery disease (PAD) was significantly associated with ED in the subjects (OR = 2.867, 95% CI = 1.360 - 6.044, P = 0.006). However, no significant correlation was found between ED and obesity, duration of diabetes mellitus, antihypertensive medications use and duration of hypertension among the subjects (P > 0.05). <strong>Conclusion:</strong> Poor glycaemic control and presence of PAD significantly increase the risk of ED in male subjects with type 2 DM, thus underscoring the need for an early screening and treatment of these predictors of erectile dysfunction.展开更多
Pteropine orthoreovirus(PRV)is a nonenveloped double-stranded RNA(dsRNA)virus of the genus Orthoreovirus under the family Reoviridae.The PRV genome is composed of 10 dsRNA segments,including three large(L)segments,thr...Pteropine orthoreovirus(PRV)is a nonenveloped double-stranded RNA(dsRNA)virus of the genus Orthoreovirus under the family Reoviridae.The PRV genome is composed of 10 dsRNA segments,including three large(L)segments,three medium(M)segments,and four small(S)segments surrounded by an icosahedral capsid[1].展开更多
Next-generation cellular networks are expected to provide users with innovative gigabits and terabits per second speeds and achieve ultra-high reliability,availability,and ultra-low latency.The requirements of such ne...Next-generation cellular networks are expected to provide users with innovative gigabits and terabits per second speeds and achieve ultra-high reliability,availability,and ultra-low latency.The requirements of such networks are the main challenges that can be handled using a range of recent technologies,including multi-access edge computing(MEC),artificial intelligence(AI),millimeterwave communications(mmWave),and software-defined networking.Many aspects and design challenges associated with the MEC-based 5G/6G networks should be solved to ensure the required quality of service(QoS).This article considers developing a complex MEC structure for fifth and sixth-generation(5G/6G)cellular networks.Furthermore,we propose a seamless migration technique for complex edge computing structures.The developed migration scheme enables services to adapt to the required load on the radio channels.The proposed algorithm is analyzed for various use cases,and a test bench has been developed to emulate the operator’s infrastructure.The obtained results are introduced and discussed.展开更多
This paper deals with both the leading train and the following train in a train tracking under a four-aspect fixed autoblock system in order to study the optimum operating strategy for energy saving.After analyzing th...This paper deals with both the leading train and the following train in a train tracking under a four-aspect fixed autoblock system in order to study the optimum operating strategy for energy saving.After analyzing the working principle of the four-aspect fixed autoblock system,an energy-saving control model is created based on the dynamics equation of the trains.In addition to safety,energy consumption and time error are the main concerns of the model.Based on this model,dynamic speed constraints of the following train are proposed,defined by the leading train dynamically.At the same time,the static speed constraints defined by the line conditions are also taken into account.The parallel genetic algorithm is used to search the optimum operating strategy.In order to simplify the solving process,the external punishment function is adopted to transform this problem with constraints to the one without constraints.By using the real number coding and the strategy of dividing ramps into three parts,the convergence of GA is accelerated and the length of chromosomes is shortened.The simulation result from a four-aspect fixed autoblock system simulation platform shows that the method can reduce the energy consumption effectively in the premise of ensuring safety and punctuality.展开更多
In Sierra Leone, poor water quality is a major threat to public health and aquatic life. The main source of this problem appears to be poorly?regulated waste disposal. Even though water pollution laws exist, their enf...In Sierra Leone, poor water quality is a major threat to public health and aquatic life. The main source of this problem appears to be poorly?regulated waste disposal. Even though water pollution laws exist, their enforcement is challenged by many gaps and,?seemingly, they?focus on the quest to sustain natural resource exploitation. This work presents a case for?strengthening?such laws to promote public health, economic growth, and resource conservation. The article presents examples of problems that necessitated promulgation of water pollution laws in the US and the UK. Sierra Leone has been affected by similar problems such as public health, war efforts, and industrialization.展开更多
Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as micr...Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.展开更多
Two dimensional asynchronous spectra were used to characterize coordination between carbonyl group of butanone and metal ions by using an approach proposed in our recent paper.Spectral variation of n-π~*transition ba...Two dimensional asynchronous spectra were used to characterize coordination between carbonyl group of butanone and metal ions by using an approach proposed in our recent paper.Spectral variation of n-π~*transition band of carbonyl group is used to probe the coordination even if metal ions does not possess any characteristic peak in spectra.Experimental results indicate that Ca^(2+) and Al^(3+) show considerable ability to coordinate with the carbonyl group of butanone and bring about spectral variation of the n-π~*transition band,which is manifested by cross peaks in 2D asynchronous spectra.展开更多
The effects of the mechanical factors with applied loads on the tribological performance of refined,bleached and deodorised(RBD) palm stearin(PS) were studied using a four-ball tribotester.All the RBD PS results were ...The effects of the mechanical factors with applied loads on the tribological performance of refined,bleached and deodorised(RBD) palm stearin(PS) were studied using a four-ball tribotester.All the RBD PS results were simultaneously compared with the additive-free paraffinic mineral oil(PMO).The experiments were carried out using different loads with a constant speed in order to gain a better understanding of the mechanical processes that occurred during the experiment.For each experiment,the temperature was increased to 75 °C and was run for 1 h.In a mechanical system,lubricant plays an important role in reducing wear and friction.PS exists as a semi-solid at room temperature after the fractionation process from oil palm.Due to the increasing rate of pollution to the environment,vegetable oil was chosen as the test lubricant with regard to its biodegradability.Other advantages of vegetable oil are that it is more easily harvestable and non-toxic compared to petroleum-based oil,which made it a suitable candidate.From the experiment,RBD PS is found to have a better friction constraint reduction compared with additive-free PMO.展开更多
文摘Pharmaceutical delivery systems are developed to improve the physicochemical properties of therapeutic compounds. Emulsions are one of these drug delivering systems formulated using water, oils and lipids as main ingredients. Extensive data are usually generated on the physical and chemical characteristics of these oil-in-water and lipid emulsions. However, the oxidative tendency of emulsions is often overlooked. Oxidation impacts the overall quality and safety of these pharmaceutical emulsions. Additionally, introducing oxidatively unstable emulsions into biological systems further promotes oxidation in situ. Products of these reactions then continue to pose serious harm to cells and fuel other physiological oxidation reactions. Consequently, the increase of oxidation products leads to oxidative damage to biological systems. Thus, emulsions with lower lipid peroxidation are more stable and will reduce the negative effects of oxidation in situ. Preventive measures during the formulation of emulsions are important. Many naturally occurring and cost effective substances possess low oxidation tendencies and confer oxidative protection when used in emulsions. Additionally,certain preparatory methods should be employed to reduce or better control lipid peroxidation.Finally, emulsions must be evaluated for their oxidation susceptibility using the various techniques available. Careful attention to the preparation of emulsions and assessment of their oxidative stability will help produce safer emulsions without compromising efficacy.
基金financially supported by Diponegoro University,Semarang,Indonesia (31419/UN7.5.1/PG/2015 and 573-18/UN7.5.1/PG/2016)
文摘Detection of oil pollution in soil has been carried out using laser-induced breakdown spectroscopy(LIBS). A pulsed neodymium-doped yttrium aluminum garnet(Nd:YAG) laser(1,064 nm, 8 ns, 200 mJ) was focused onto pelletized soil samples. Emission spectra were obtained from oil-contaminated soil and clean soil. The contaminated soil had almost the same spectrum profile as the clean soil and contained the same major and minor elements. However, a C–H molecular band was clearly detected in the oil-contaminated soil, while no C–H band was detected in the clean soil. Linear calibration curve of the C–H molecular band was successfully made by using a soil sample containing various concentrations of oil. The limit of detection of the C–H band in the soil sample was 0.001 mL/g. Furthermore, the emission spectrum of the contaminated soil clearly displayed titanium(Ti) lines, which were not detected in the clean soil. The existence of the C–H band and Ti lines in oil-contaminated soil can be used to clearly distinguish contaminated soil from clean soil. For comparison, the emission spectra of contaminated and clean soil were also obtained using scanning electron microscope-energy dispersive X-ray(SEM/EDX) spectroscopy,showing that the spectra obtained using LIBS are much better than using SEM/EDX, as indicated by the signal to noise ratio(S/N ratio).
文摘John Milton introduces the Biblical world into literature. Some modern critics think that in Paradise Lost, Milton makes Satan a hero while God a tyrant, yet, adopting the original Biblical perception, the reader will see the "Eternal Providence" of God and will agree that Milton has succeeded in justifying God as a Father Who says "Man Shall Find Grace". A Biblical reading of this epic will be done by focusing on its detail contents.
基金supported by the National Natural Science Foundation of China (81774105)。
文摘Objective: To investigate the bioactive components of Sangqi Qingxuan formula(SQQX), predict the pharmacological targets, and explore the mechanism of hypertensive vascular remodeling(HVR).Methods: Network pharmacology was adopted to predict how SQQX acts in HVR. The effectiveness was assessed by blood pressure measurements and pathological morphology observation based on a spontaneously hypertensive rat model, while the mechanism of SQQX on HVR was validated by immunohistochemistry(IHC) and western blot(WB) according to the results of network pharmacology.Results: There were 130 bioactive components of SQQX and 231 drug targets predicted by the Traditional Chinese Medicine Systems Pharmacology Database. Subsequently, 181 common targets were identified for SQQX against HVR, with TP53, MAPK1, and AKT1 as the core targets. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses was employed to identify the top 20 enriched functions and the top 20 pathways(P <.01). Finally, the key role of the ERK/MAPK signaling pathway in HVR was determined. The in vivo results suggested that SQQX reduced systolic blood pressure and increased the ratio of thoracic aortic wall thickness to lumen diameter. Additionally, compared with the model group, SQQX increased the expression of smooth muscle 22 alpha(IHC: P <.001;WB:P <.05) and decreased the expression of osteopontin(IHC: P <.001;WB: P <.05), ERK1/2(IHC: P <.001;WB: ERK1 & ERK2, all P <.05), p-ERK1/2(IHC: P <.001;WB: ERK1 & ERK2, all P <.05), and the ratio of pERK1/2 to ERK1/2 protein(IHC: P <.001).Conclusions: SQQX, which has multiple bioactive ingredients and potential targets, is an effective treatment for HVR. The mechanism of antihypertensive and vascular protection may be related to the inhibition of phenotypic transformation of vascular smooth muscle cells and the ERK/MAPK signaling pathway.
基金supported by grants from the Innovation Team and Talents Cultivation Program of National Administration of Traditional Chinese Medicine (ZYYCXTD-C-202003)the China Academy of Chinese Medical Sciences Evidence-based Capacity Improvement Project (ZZ13-024-7)
文摘Objective: To assess the effectiveness and safety of manipulation intervention for degenerative lumbar spondylolisthesis(DLS).Methods: This is a systematic review and meta-analysis. A full-scale retrieval method was performed until February 1, 2021, including nine databases. The homogeneity of different studies was summarized using the Review Manager. The quality of studies was determined with the Cochrane risk-of-bias tool.The evidence quality was graded with the Grading of Recommendations, Assessment, Development, and Evaluations approach.Results: A total of 6 studies involving 524 participants were included. The review demonstrated that manipulation has statistically significant improvements for treating DLS according to Japanese Orthopedic Association scores(mean difference, 3.76;95% confidence interval, 2.63 to 4.90;P <.001) and visual analog scale scores(mean difference,-1.50;95% confidence interval,-1.66 to-1.33;P <.001)compared to the control group. One study reported that the difference in the Oswestry Disability Index between the traction group and the combination of manipulation and traction group was statistically significant(P <.05), while another reported that manipulation treatment can significantly improve the lumbar spine rotation angle on X-ray images compared with the baseline data(P <.05). Moreover, the manipulation group(experimental group) had fewer adverse events than the lumbar traction group(control group).Conclusion: Manipulation intervention is more effective and safer for DLS. Nevertheless, large-scale randomized controlled trials are required to confirm the current conclusions.
文摘Objective:Penile neoplasia,usually of squamous histogenesis,is currently classfied into human papillomavirus(HPV)-related or-dependent and non-HPV-related or-indepen dent.There are distinct morphological differences among the two groups.New research studies on penile cancer from Northern countries showed that the presence of HPV is corre lated with a better prognosis than virus negative people,while studies in Southern countries had not confirmed,perhaps due to differences in staging or treatment.Methods:We focused on the description of the HPV.related carcinomas of the penis.The approach was to describe common clinical features followed by the pathological features of each entity or subtype stressing the characteristics for differential diagnosis,HPV genotypes,and prognostic features of the invasive carcinomas.Similar structure was followed for penile intraepithelial neoplasia,except for prognosis because of the scant evidence available.Results:Most of HPV-related lesions can be straightforwardly recognized by routine hematoxylin and eosin stains,but in some cases surrogate p16 immunohistochemical staining or molecular methods such as in situ hybridization or polymerase chain reaction can be utilized.Currently,there are eight tumor invasive variants associated with HPV,as follows:basaloid,warty,warty-basaloid,papillary basaloid,clear cell,medullary,lymphoepithelioma-like,and giant condylomas with malignant transformation.Conclusion:This review presents and describes the heterogeneous clinical,morphological,and genatypic features of the HPV-related subtypes of invasive and non-invasive penile neoplasia.
基金This work was supported by the TCM Special Research Projects Program 2010,China Ministry of Science and Technology(201007002)the TCM Special Research Projects Program 2014Ministry of Science and Technology(201407001-8).
文摘Objective:To provide guidelines for the prevention of post-stroke dementia,we investigated whether stroke patients were aware of post-stroke dementia and their level of dementia-related knowledge.Methods:Five dementia-related questions were designed.A field survey was conducted in a questionand-answer method using the designed questions.The surveys assessed 3000 stroke patients(2 weekse6 months after stroke attacks)from 14 hospitals/clinical centers in 7 provinces and cities across China.Results:Among 3000 stroke patients,80.5%had heard of dementia,39.1%knew that stroke can lead to dementia,55.7%believed dementia can be prevented,50.8%thought dementia can be cured,and only 8.8%had ever seen a doctor because of memory deterioration.Then,patients were classified into three groups,including a no cognitive impairment(NCI)group,a mild cognitive impairment(MCI)group,and a mild dementia(MD)group.Among the MCI and MD groups,only 8.7%(75/861)and 9.9%(64/649)of patients,respectively,had ever seen a doctor because of memory deterioration.According to our results,patients with a higher level of cognitive impairment had a lower awareness of dementia(P<.001).Conclusion:The awareness of dementia in stroke patients in China is low,and the consultation rate is even lower.Moreover,patients with a higher level of cognitive impairment have a lower awareness of dementia.To improve public awareness and improve prevention,more emphasis should be put on education regarding post-stroke dementia.Routine cognitive function screening should be conducted on stroke patients as an effective way to assess dementia.
基金This work was supported by Natural Science Foundation of Beijing Municipality(7202118).
文摘Objective:To initially explore traditional Chinese medicine patterns in a bleomycin-induced pulmonary fibrosis mouse model.Methods:Thirty-six C57BL/6 mice were divided by the random number table method(with 12 rats per group)into three groups:a blank group,a model group,and a number 2 Feibi recipe(FBR-2)group.The pulmonary fibrosis mouse model was established by intratracheal instillation of bleomycin.The FBR-2 group was treated with FBR-2 for 4 weeks.Symptoms in the mice such as mental behavior,food/water intake,body weight,body temperature,respiratory rate,and tongue image were observed.The samples were collected on the 14th day and 28th day after modeling,and lung tissues were visually assessed and microscopically evaluated by staining with hematoxylin-eosin and Masson.The expression levels of hydroxyproline,interleukin(IL)-33,IL-37,tissue plasminogen activator,and plasminogen activator inhibitor-1 were determined by enzyme-linked immunosorbent assay.Results:Mice in the model group were poor in spirit,less active,slow in response,showed reduced food/water intake,body temperature,and body weight,increased respiratory rate,and their tongue color had changed from light red to dark red.However,treatment with FBR-2 significantly improved these symptoms.Extensive inflammatory cell infiltration and collagen fiber deposition were observed in the lung tissues of the model group.Compared with the blank group,the levels of hydroxyproline,IL-33,and plasminogen activator inhibitor-1 in the model group significantly increased(all P<.05),whereas that of tissue plasminogen activator significantly decreased on the 14th day and 28th day(P=.036 and P=.005,respectively).Moreover,FBR-2 improved lung inflammation and fibrinolysis imbalance and reduced collagen fiber deposition.Conclusion:To some extent,our bleomycin-induced pulmonary fibrosis mouse model exhibited traditional Chinese medicine patterns of qi deficiency,blood stasis,and heat retention.
文摘Differentiated embryonic stem cells (ESC) can ameliorate lung inflammation and fibrosis in animal lung injury models;therefore, ESC, or their products, could be candidates for regenerative therapy for incurable lung diseases, such as idiopathic pulmonary fibrosis (IPF). In this study, we have investigated the paracrine effect of differentiated and undifferentiated human ESC on alveolar epithelial cell (AEC) wound repair. hESC line, SHEF-2 cells were differentiated with Activin treatment for 22 days in an embryoid body (EB) suspension culture. Conditioned media (CM) which contain cell secretory factors were collected at different time points of differentiation. CM were then tested onin vitro?wound repair model with human type II AEC line, A549 cells (AEC). Our study demonstrated that CM originated from undifferentiated hESC significantly inhibited AEC wound repair when compared to the control. Whereas, CM originated from Activin-directed hESC differentiated cell population demonstrated a differential reparative effect on AEC wound repair model. CM obtained from Day-11 of differentiation significantly enhanced AEC wound repair in comparison to CM collected from pre- and post-Day-11 of differentiation. Day-11 CM enhanced AEC wound repair through significant stimulation of cell migration and cell proliferation. RT-PCR and immunocytochemistry confirmed that Day-11 CM was originated form a mixed population of endodermal/mesodermal differentiated hESC. This report suggests a putative paracrine-mediated epithelial injury healing mechanism by hESC secreted products, which is valuable in the development of novel stem cell-based therapeutic strategies.
文摘Objective:To evaluate the effects of Liuzijue respiratory exercise in patients with chronic obstructive pulmonary disease(COPD).Method:Randomly controlled trials of Liuzijue respiratory exercise in the treatment of COPD were searched in the database,including PubMed,Embase,Web of Science,Cochrane Library,CNKI,Wanfang,CBM,and VIP.Study screening,data extraction,and quality assessment were conducted by two researchers independently.Data were analyzed using RevMan 5.3 software.Results:11 studies with 915 COPD patients were included.Results of meta-analysis showed that compared with conventional care,Liuzijue respiratory exercise had shown better effects on FEV1(Forced expiratory volume in 1 second)[MD=0.18,95%CI(0.06,0.30),P=0.004],FEV1%pred[MD=10.21,95%CI(7.25,13.18),P<0.001],FEV1/FVC%(Forced vital capacity)[MD=8.32,95%CI(3.23,13.40),P<0.001],6-minute walk distance[MD=10.97,95%CI(5.81,16.12),P<0.001]and life quality[MD=-10.07,95%CI(-12.84,-7.30),P<0.001].However,no difference was observed in the effective rate between these two groups.Compared with whole body respiratory exercise,except for the better effects on 6-minute walk distance[MD=37.82,95%CI(6.51,69.13),P=0.02],no difference in FEV1,FEV1%pred,FEV1/FVC%and life quality were observed between these two groups.Conclusion:Liuzijue respiratory exercise can better improve lung function,functional capacity,and life quality of COPD patients compared with conventional care.Compared with the whole body respiratory exercise,Liuzijue could improve the functional capacity of COPD patients significantly and showed similar effcets on lung function and life quality.
文摘<strong>Introduction: </strong>Erectile dysfunction (ED) is a common complication of diabetes mellitus (DM) that is associated with poor quality of life and can be present in type 2 diabetics at the time of diagnosis. There are common risk factors associated with erectile dysfunction in type 2 diabetic subjects. Some of these are potentially treatable or reversible. The risk factors evaluated by this study included glycaemic control, duration of diabetes, obesity, peripheral artery disease (PAD), hypertension and antihypertensive medications use. <strong>Materials and Methods:</strong> This study was a cross sectional one carried out over a period of six months (June-November, 2016) at the diabetes clinic of the Nnamdi Azikiwe University Teaching Hospital, Nnewi and involved 124 subjects with type 2 diabetes mellitus. A convenience sampling method was used. A detailed physical examination, blood pressure and anthropometric measurements and vascular assessment with a hand-held doppler ultrasound were carried out. Data was collected using a study proforma. Erectile dysfunction was diagnosed with the International Index of Erectile Function questionnaire while anxiety and depression were diagnosed with the Hospital Anxiety and Depression questionnaires. Subjects that had anxiety/depression or hypogonadism were excluded from the study. <strong>Results:</strong> A total of 124 subjects were studied, 48.4% of whom had erectile dysfunction. Glycaemic control was significantly associated with ED among the subjects (OR = 0.198, 95% CI = 0.081 - 0.483, P < 0.001). Similarly, peripheral artery disease (PAD) was significantly associated with ED in the subjects (OR = 2.867, 95% CI = 1.360 - 6.044, P = 0.006). However, no significant correlation was found between ED and obesity, duration of diabetes mellitus, antihypertensive medications use and duration of hypertension among the subjects (P > 0.05). <strong>Conclusion:</strong> Poor glycaemic control and presence of PAD significantly increase the risk of ED in male subjects with type 2 DM, thus underscoring the need for an early screening and treatment of these predictors of erectile dysfunction.
基金supported by the Fundamental Research Grant Scheme (FRGS)2019-1 (FRGS/1/2019/STG05/IMU/02/1)from the Ministry of Higher Education,Malaysia,International Medical University Research Grant (BP I-01-2018 (33))Pump priming Grant (F0013.54.04)University of Nottingham Malaysia。
文摘Pteropine orthoreovirus(PRV)is a nonenveloped double-stranded RNA(dsRNA)virus of the genus Orthoreovirus under the family Reoviridae.The PRV genome is composed of 10 dsRNA segments,including three large(L)segments,three medium(M)segments,and four small(S)segments surrounded by an icosahedral capsid[1].
基金This work was supported by Princess Nourah bint Abdulrahman University Researchers Supporting Project Number(PNURSP2022R308),Princess Nourah bint Abdulrahman University,Riyadh,Saudi Arabia.
文摘Next-generation cellular networks are expected to provide users with innovative gigabits and terabits per second speeds and achieve ultra-high reliability,availability,and ultra-low latency.The requirements of such networks are the main challenges that can be handled using a range of recent technologies,including multi-access edge computing(MEC),artificial intelligence(AI),millimeterwave communications(mmWave),and software-defined networking.Many aspects and design challenges associated with the MEC-based 5G/6G networks should be solved to ensure the required quality of service(QoS).This article considers developing a complex MEC structure for fifth and sixth-generation(5G/6G)cellular networks.Furthermore,we propose a seamless migration technique for complex edge computing structures.The developed migration scheme enables services to adapt to the required load on the radio channels.The proposed algorithm is analyzed for various use cases,and a test bench has been developed to emulate the operator’s infrastructure.The obtained results are introduced and discussed.
基金supported by the National Science & Technology Pillar Program during the Eleventh Five-Year Plan Period of China (No.2009BAG12A05)
文摘This paper deals with both the leading train and the following train in a train tracking under a four-aspect fixed autoblock system in order to study the optimum operating strategy for energy saving.After analyzing the working principle of the four-aspect fixed autoblock system,an energy-saving control model is created based on the dynamics equation of the trains.In addition to safety,energy consumption and time error are the main concerns of the model.Based on this model,dynamic speed constraints of the following train are proposed,defined by the leading train dynamically.At the same time,the static speed constraints defined by the line conditions are also taken into account.The parallel genetic algorithm is used to search the optimum operating strategy.In order to simplify the solving process,the external punishment function is adopted to transform this problem with constraints to the one without constraints.By using the real number coding and the strategy of dividing ramps into three parts,the convergence of GA is accelerated and the length of chromosomes is shortened.The simulation result from a four-aspect fixed autoblock system simulation platform shows that the method can reduce the energy consumption effectively in the premise of ensuring safety and punctuality.
文摘In Sierra Leone, poor water quality is a major threat to public health and aquatic life. The main source of this problem appears to be poorly?regulated waste disposal. Even though water pollution laws exist, their enforcement is challenged by many gaps and,?seemingly, they?focus on the quest to sustain natural resource exploitation. This work presents a case for?strengthening?such laws to promote public health, economic growth, and resource conservation. The article presents examples of problems that necessitated promulgation of water pollution laws in the US and the UK. Sierra Leone has been affected by similar problems such as public health, war efforts, and industrialization.
文摘Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
基金financially supported by the National Natural Science Foundation of China(No.51373003)Beijing Natural Science Foundation(No.2122059)
文摘Two dimensional asynchronous spectra were used to characterize coordination between carbonyl group of butanone and metal ions by using an approach proposed in our recent paper.Spectral variation of n-π~*transition band of carbonyl group is used to probe the coordination even if metal ions does not possess any characteristic peak in spectra.Experimental results indicate that Ca^(2+) and Al^(3+) show considerable ability to coordinate with the carbonyl group of butanone and bring about spectral variation of the n-π~*transition band,which is manifested by cross peaks in 2D asynchronous spectra.
基金Project supported by the Research University Grant from Universiti Teknologi Malaysia (No. 00J02)the Fundamental Research Grant Scheme from the Ministry of Higher Education (MOHE) (No. 78604)the E-Science Grant from the Ministry of Science,Technology and Innovation of Malaysia (No. 79396)
文摘The effects of the mechanical factors with applied loads on the tribological performance of refined,bleached and deodorised(RBD) palm stearin(PS) were studied using a four-ball tribotester.All the RBD PS results were simultaneously compared with the additive-free paraffinic mineral oil(PMO).The experiments were carried out using different loads with a constant speed in order to gain a better understanding of the mechanical processes that occurred during the experiment.For each experiment,the temperature was increased to 75 °C and was run for 1 h.In a mechanical system,lubricant plays an important role in reducing wear and friction.PS exists as a semi-solid at room temperature after the fractionation process from oil palm.Due to the increasing rate of pollution to the environment,vegetable oil was chosen as the test lubricant with regard to its biodegradability.Other advantages of vegetable oil are that it is more easily harvestable and non-toxic compared to petroleum-based oil,which made it a suitable candidate.From the experiment,RBD PS is found to have a better friction constraint reduction compared with additive-free PMO.
